View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1881_low_7 (Length: 247)
Name: NF1881_low_7
Description: NF1881
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1881_low_7 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 105; Significance: 1e-52; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 86 - 237
Target Start/End: Original strand, 55170346 - 55170501
Alignment:
| Q |
86 |
aatggtccttacaaacaaatattcataattttggatagtatttt--ttaagtacaaaaaggttacaactgtgacaatctatgattgccgtgtttacat-- |
181 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
55170346 |
aatggtccttacaaacaaatattcagaattttggatagtattttttttaagtacaaaaaggttacaactgggacaatctatgattgccgtgtttacattg |
55170445 |
T |
|
| Q |
182 |
tgattcgaatccagnnnnnnncttcttatgcacttgattttctttcatttcagaat |
237 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
55170446 |
tgattcgaatccagtttttttcttcttatgcacttgattttctttcatttcagaat |
55170501 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 1 - 78
Target Start/End: Original strand, 55170196 - 55170273
Alignment:
| Q |
1 |
ctgtctcacagttatacttactaccttttccttttgtttcctaatttctaattctaattatgaccgattgtctgttaa |
78 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
55170196 |
ctgtctcacagttatacttactaccttttccttttgtttcctaatttctaattctaattatgacagattgtctgttaa |
55170273 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University