View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18822_high_10 (Length: 216)

Name: NF18822_high_10
Description: NF18822
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18822_high_10
NF18822_high_10
[»] chr4 (1 HSPs)
chr4 (1-162)||(11122608-11122766)


Alignment Details
Target: chr4 (Bit Score: 126; Significance: 4e-65; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 1 - 162
Target Start/End: Original strand, 11122608 - 11122766
Alignment:
1 gtagagaggacaatttatggcttctcaatatgtgactttttcaaccgagaatcggtttattaattgttcaagccattaatcagtcaatgattggcacatt 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||    |||||||||||||||||||    
11122608 gtagagaggacaatttatggcttctcaatatgtgactttttcaaccgagcatcggtttattaattgttcaagccatt----agtcaatgattggcacatt 11122703  T
101 ttgatacagcaacaaataaatttggggctg-aaattcaaatgcaataatccatgtatgcattt 162  Q
    |||||||||||  ||||||||||||||||| ||||||||||||||||||||||||||||||||    
11122704 ttgatacagcaggaaataaatttggggctgtaaattcaaatgcaataatccatgtatgcattt 11122766  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University