View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18822_high_7 (Length: 243)
Name: NF18822_high_7
Description: NF18822
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18822_high_7 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 1 - 228
Target Start/End: Complemental strand, 40030037 - 40029810
Alignment:
| Q |
1 |
ttggtatttggaacaaaaccgcacccaagattgtagcatccagtttgatatccatccttctgcaattattactattattttcttattaatgtgtatgtta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40030037 |
ttggtatttggaacaaaaccgcacccaagattgtagcatccagtttgatatccatccttctgcaattattactattattttcttattaatgtgtatgtta |
40029938 |
T |
 |
| Q |
101 |
gaaacaaatataaattaccttcacgtcagaaaaaatataatttacttaccgtcataaagataaacaatctagggagattgtccccgttaaatttagggtc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40029937 |
gaaacaaatataaattaccttcacgtcagaaaaaatataatttacttaccgtcataaagataaacaatctagggagattgtccccgttaaatttagggtc |
40029838 |
T |
 |
| Q |
201 |
cgcctgcataaatgttacttgatcttag |
228 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
40029837 |
cgcctgcataaatgttacttgatcttag |
40029810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 133 - 187
Target Start/End: Complemental strand, 29246557 - 29246503
Alignment:
| Q |
133 |
aaatataatttacttaccgtcataaagataaacaatctagggagattgtccccgt |
187 |
Q |
| |
|
|||||||| |||||||| ||| |||| |||||||||||||| |||||||||||| |
|
|
| T |
29246557 |
aaatataaattacttacagtccaaaaggtaaacaatctagggcgattgtccccgt |
29246503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University