View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18823_high_12 (Length: 246)
Name: NF18823_high_12
Description: NF18823
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18823_high_12 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 15 - 227
Target Start/End: Complemental strand, 48890434 - 48890222
Alignment:
| Q |
15 |
ttattctgaaattaaatcccaaacacgaacgcaactatcttctcccgaactgaccactctttctggctcaataaaagtcaagccatacactccacctaaa |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48890434 |
ttattctgaaattaaatcccaaacacgaacgcaactatcttctcccgaactgaccactctttctggctcaataaaagtcaagccatacactccacctaaa |
48890335 |
T |
 |
| Q |
115 |
tgagccccttttatggttctgcggcttgatgctggctttccaatttcgtatacaataacacatgtatcaagtgaaccagtagctaccagtttgctattag |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48890334 |
tgagccccttttatggttctgcggcttgatgctggctttccaatttcgtatacaataacacatgtatcaagtgaaccagtagctaccagtttgctattag |
48890235 |
T |
 |
| Q |
215 |
gtgaccaagcaag |
227 |
Q |
| |
|
||||||||||||| |
|
|
| T |
48890234 |
gtgaccaagcaag |
48890222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University