View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18823_low_18 (Length: 226)
Name: NF18823_low_18
Description: NF18823
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18823_low_18 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 133; Significance: 3e-69; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 20 - 218
Target Start/End: Complemental strand, 8931475 - 8931271
Alignment:
| Q |
20 |
ataaacactggttaatttgtcgcaatgtgaaaaaatagccatgcatgattgttgattttatcatcactcacatgattta----agtagataagaaaaata |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
8931475 |
ataaacactggttaatttgtcgcaatgtgaaaaaatagccatgcatgattgttgattttatcatcactcacatgatttaagtaagtagataagaaaaata |
8931376 |
T |
|
| Q |
116 |
tatgctcttac--nnnnnnnngtacataagaaaaatcatcttccatgtttattttgttacaaggggaaacgtcgtggttctcttgtaattgacctttgct |
213 |
Q |
| |
|
||||||||||| |||||||| |||||||||||||||||| |||||||||| ||||||||||||||||||||||| |||||||| ||||||| |
|
|
| T |
8931375 |
tatgctcttacaaaaaaaaaagtacataacaaaaatcatcttccatgtatattttgttataaggggaaacgtcgtggttctctcgtaattgatctttgct |
8931276 |
T |
|
| Q |
214 |
tctcc |
218 |
Q |
| |
|
||||| |
|
|
| T |
8931275 |
tctcc |
8931271 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University