View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18826_high_10 (Length: 220)

Name: NF18826_high_10
Description: NF18826
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18826_high_10
NF18826_high_10
[»] chr8 (1 HSPs)
chr8 (27-114)||(24976133-24976220)


Alignment Details
Target: chr8 (Bit Score: 76; Significance: 3e-35; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 27 - 114
Target Start/End: Original strand, 24976133 - 24976220
Alignment:
27 tatagtgtacacaaattattatctggaactcaatgtttctctcttctctatcaacatgattgcaatcatattttgattatctttaata 114  Q
    ||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||| ||||||||||||||||||    
24976133 tatagtgtacacaaattattatctggaactcaatgtttctcccttctccatcaacatgattgcaatcatgttttgattatctttaata 24976220  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University