View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18826_low_10 (Length: 242)
Name: NF18826_low_10
Description: NF18826
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18826_low_10 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 44 - 242
Target Start/End: Complemental strand, 19642500 - 19642302
Alignment:
| Q |
44 |
tatgatgcatccctttcacttcttactcacttcaagggaacacagtccatttgtaatatgccctacttataaattagaagaggaaggcaaggcttcctta |
143 |
Q |
| |
|
||||||||||||||||||||| |||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19642500 |
tatgatgcatccctttcacttgttactcacttaaagggaacacagtccatttgtagtatgccctacttataaattagaagaggaaggcaaggcttcctta |
19642401 |
T |
|
| Q |
144 |
atccttaacaagaacattggtaataagtaatgtttcaaaaatcaaacgggacggttcaaggtaaaccgcaaatcaattttctgtacggttcggttattt |
242 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||| |||||| |
|
|
| T |
19642400 |
atccttaacaagaacattggtaataagtaatgtttcaaaaatcaaactggacggttcaaggtgaaccgcaaatcaattttctgtacggttcgattattt |
19642302 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University