View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18826_low_11 (Length: 238)
Name: NF18826_low_11
Description: NF18826
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18826_low_11 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 1 - 219
Target Start/End: Original strand, 27808862 - 27809080
Alignment:
| Q |
1 |
atggttaaagggttggtgttagaacgttgtcctgatttgaatcttgagttaacaattagtccaccacgtgttcaagaacatgatgaacaattcagaaaca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27808862 |
atggttaaagggttggtgttagaacgttgtcctgatttgaatcttgagttaacaattagtccaccacgtgttcaagaacatgatgaacaattcagaaaca |
27808961 |
T |
|
| Q |
101 |
gagaaaggaacaatctctgttttgtttgtagtttgggtttgcagaatagtaaggattgtatctgtgatgaaattgttggaaattctagcagtggaaatgg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27808962 |
gagaaaggaacaatctctgttttgtttgtagtttgggtttgcagaatagtaaggattgtacctgtgatgaaattgttggaaattctagcagtggaaatgg |
27809061 |
T |
|
| Q |
201 |
ttctactgcacctgcttat |
219 |
Q |
| |
|
||| ||||||||||||||| |
|
|
| T |
27809062 |
ttccactgcacctgcttat |
27809080 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University