View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18826_low_13 (Length: 220)
Name: NF18826_low_13
Description: NF18826
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18826_low_13 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 76; Significance: 3e-35; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 27 - 114
Target Start/End: Original strand, 24976133 - 24976220
Alignment:
| Q |
27 |
tatagtgtacacaaattattatctggaactcaatgtttctctcttctctatcaacatgattgcaatcatattttgattatctttaata |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
24976133 |
tatagtgtacacaaattattatctggaactcaatgtttctcccttctccatcaacatgattgcaatcatgttttgattatctttaata |
24976220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University