View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18826_low_9 (Length: 251)
Name: NF18826_low_9
Description: NF18826
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18826_low_9 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 134; Significance: 7e-70; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 134; E-Value: 7e-70
Query Start/End: Original strand, 63 - 250
Target Start/End: Original strand, 7427502 - 7427686
Alignment:
| Q |
63 |
ctacatgtcaagacccaaacacaataagggattaaaccactactaattatgataatcgagagcaaagtagcattttttgttttcaaccaccaaaacgaaa |
162 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||| |||||||||||| |||||||||||||| |||||||| |||| ||||||||||||| |
|
|
| T |
7427502 |
ctacatgtcaagacccaaacacataaagggattaaaccacta---attatgataatcaagagcaaagtagcactttttgttatcaaacaccaaaacgaaa |
7427598 |
T |
|
| Q |
163 |
ggaacttaattttctctaacaattgttgcagttgttgttccttatgattaaatattatgttatttctttcttttcagattacccaaac |
250 |
Q |
| |
|
||| |||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7427599 |
ggagtttaattttctctaacaattgttgcggttgttgttccttaggattaaatattatgttatttctttcttttcagattacccaaac |
7427686 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 107 - 183
Target Start/End: Original strand, 36024645 - 36024721
Alignment:
| Q |
107 |
aattatgataatcgagagcaaagtagcattttttgttttcaaccaccaaaacgaaaggaacttaattttctctaaca |
183 |
Q |
| |
|
||||||||||| ||| || ||| || ||| ||||| |||||||||||||||||||| | ||| ||||| ||||||| |
|
|
| T |
36024645 |
aattatgataaccgaaagtaaattaacatgttttgccttcaaccaccaaaacgaaagaagctttattttatctaaca |
36024721 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University