View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18827_low_15 (Length: 359)
Name: NF18827_low_15
Description: NF18827
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18827_low_15 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 316; Significance: 1e-178; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 316; E-Value: 1e-178
Query Start/End: Original strand, 14 - 349
Target Start/End: Complemental strand, 12123223 - 12122888
Alignment:
| Q |
14 |
attattttcccttcattttgggatacttttgaggcacttttaagggaagaaacagttacataagcagctcaaaggaaacacatgaaaatcaagaattgct |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12123223 |
attattttcccttcattttgggatacttttgaggcacttttaagggaagaaacagttacataagcagctcaaaggaaacacatgaaaatcaagaattgct |
12123124 |
T |
 |
| Q |
114 |
actagcatactacatagcatgcatgatatacatgtgtattgtattatccgggatgatgattttaatttgtcgaaaaacatggtcgatacggttgaaattg |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12123123 |
actagcatactacatagcatgcatgatatacatgtgtattgtattatccgggatgatgattttaatttgtcgaaaaacatggtcgatacggttgaaattg |
12123024 |
T |
 |
| Q |
214 |
cagttgtgttactattgcggaaaattcagaatcatttatattgcaaccgcggttgtagaccgcaatttaaatccatgtcaaggatttatctccataacca |
313 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||| || | |
|
|
| T |
12123023 |
cagttgtgttactattgcggaaaattcagaatcatttatattgcaactgcggttgtagaccgcaatttaaatccatgtcaaggatttatccccatgacta |
12122924 |
T |
 |
| Q |
314 |
gtagttgtagggctaattcgagaagttagagtatta |
349 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||| |
|
|
| T |
12122923 |
gtagttgtagggctaattcgagaagttcgagtatta |
12122888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University