View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18827_low_16 (Length: 331)
Name: NF18827_low_16
Description: NF18827
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18827_low_16 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 12 - 214
Target Start/End: Original strand, 52542440 - 52542642
Alignment:
| Q |
12 |
tcatcaagaagttcataaacaaggacgaaattctttcgaaaagagtcttcattaagaacaccaaggtaatctttgataacacgtgcagttctatgtaaaa |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
52542440 |
tcatcaagaagttcataaacaaggacgaaattctttcgaaaagagtcttcattaagaacaccaaggtaatctttgatgacacgtgcagttctatgtaaaa |
52542539 |
T |
|
| Q |
112 |
gttccaaaacaagagaaggagaaacattgattctagttgtagcaacaaataataacccagcaaccttcacgtggaagtagttcacaccatctacattcta |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52542540 |
gttccaaaacaagagaaggagaaacattgattctagttgtagcaacaaataataacccagcaaccttcacgtggaagtagttcacaccatctacattcta |
52542639 |
T |
|
| Q |
212 |
ttc |
214 |
Q |
| |
|
||| |
|
|
| T |
52542640 |
ttc |
52542642 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University