View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18827_low_19 (Length: 300)
Name: NF18827_low_19
Description: NF18827
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18827_low_19 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 17 - 288
Target Start/End: Complemental strand, 40621528 - 40621257
Alignment:
| Q |
17 |
tggtaacaaaagttggacagctccagcacctagaatccatagccaaaaaacaacagcagcagcagcaacaaaattgcatgtaaaaccactacctcaattg |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
40621528 |
tggtaacaaaagttggacagctccagcacctagaatccatagccaaaaaacagcagcagcagcaacaacaaaattgcatgtaaaaccactacctcaattg |
40621429 |
T |
|
| Q |
117 |
aagcctaaaaaacttttaatcatagtaacaccaacaagcacaaaactaccttatcgcaatgnnnnnnngagaaggttggcaaatactataaagcttgttg |
216 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
40621428 |
aagcctaaaagacttttaatcatagtaacaccaacaagcacaaaactaccttatcacaatgtttttttgagaaggttggcaaatactataaagcttgttg |
40621329 |
T |
|
| Q |
217 |
atcaaccattgctttggattgttgtcgaagcgaaaaccgaatcaactgaattgccagagatattgaggaaaa |
288 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40621328 |
atcaaccattgctttggattgttgtcgaagcgaaaaccgaatcaactgaattgccagagatattgaggaaaa |
40621257 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University