View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18829_low_18 (Length: 208)
Name: NF18829_low_18
Description: NF18829
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18829_low_18 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 129; Significance: 6e-67; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 129; E-Value: 6e-67
Query Start/End: Original strand, 15 - 155
Target Start/End: Original strand, 38113265 - 38113405
Alignment:
| Q |
15 |
aatatatagtttatcatggattccttgttgcccacgttttgtgttattggcgatttgtgttggggcgagaataatcaagtgatagtttgaggcaaacatt |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
38113265 |
aatatatagtttatcatggattccttgttgcccacgttttgtgttattggcgatttgtgttggggcgagaataatcaagtgataatttgaggcaaacatt |
38113364 |
T |
|
| Q |
115 |
aatggtacaatgagaaaacgacaaatacgacttattgagag |
155 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
38113365 |
aatggtacaatgagaaaaagacaaatacgacttgttgagag |
38113405 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University