View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18829_low_5 (Length: 406)
Name: NF18829_low_5
Description: NF18829
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18829_low_5 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 48; Significance: 3e-18; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 4 - 83
Target Start/End: Original strand, 15079414 - 15079493
Alignment:
| Q |
4 |
tggacatcatcaagtttaatgatttcagttgagtgaaactctagtttggtgtgcttaatatcttcaaagaagcaaggttt |
83 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| | | || ||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
15079414 |
tggagatcatcaagtttaatgatttcagttgagagcagcttgagtttggtgtgctcaatatcttcagagaagcaaggttt |
15079493 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University