View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18829_low_7 (Length: 331)
Name: NF18829_low_7
Description: NF18829
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18829_low_7 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 250; Significance: 1e-139; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 16 - 309
Target Start/End: Complemental strand, 38041861 - 38041574
Alignment:
| Q |
16 |
tgtggctccaaaaattatcaatactcctctctttgtttcggtattggatggcataagaatttggagaatagaaggtaatggtgagtattttgtaaaaagg |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
38041861 |
tgtggctccaaaaattatcaatactcctctct--gtttcggtattggatggcataagaatttggagaatagaagataatggtgagtattttgtaaaaagg |
38041764 |
T |
 |
| Q |
116 |
gcttaccgtttgtgtttacaggagcttaattatagaacatctcatttcaagataaatggctcagaatttgatttggaagcttaaagcacctctgaaggtg |
215 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38041763 |
gcttaccgtttgtgttcacaggagctta----tagaacatctcatttcaagataaatggcccagaatttgatttggaagcttaaagcacctctgaaggtg |
38041668 |
T |
 |
| Q |
216 |
atgaacatgattttgtgtgtgtgggaagtgtcttccaactcacatgagacttcgagataaagttgtgaattgtccaaattgtgaactatatgta |
309 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
38041667 |
atgaacatgattttgtgtgtgtgggaagtgtcttccaactcacatgagacttcgagataaaattgtgaattgtccaaattgtgaactatatgta |
38041574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University