View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1883-3-Insertion-1 (Length: 58)
Name: NF1883-3-Insertion-1
Description: 454-NF1883-3
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1883-3-Insertion-1 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 38; Significance: 0.0000000000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 38; E-Value: 0.0000000000003
Query Start/End: Original strand, 15 - 52
Target Start/End: Complemental strand, 8759891 - 8759854
Alignment:
Q |
15 |
aacactaataaagagcagaaaaggggaagaagaagaag |
52 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||| |
|
|
T |
8759891 |
aacactaataaagagcagaaaaggggaagaagaagaag |
8759854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University