View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1883-3-Insertion-10 (Length: 80)

Name: NF1883-3-Insertion-10
Description: 454-NF1883-3
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1883-3-Insertion-10
NF1883-3-Insertion-10
[»] chr4 (8 HSPs)
chr4 (1-80)||(7004232-7004311)
chr4 (1-80)||(7027056-7027135)
chr4 (1-80)||(7046844-7046923)
chr4 (6-80)||(7013753-7013827)
chr4 (31-80)||(7052876-7052925)
chr4 (31-79)||(7020192-7020240)
chr4 (27-80)||(6994318-6994371)
chr4 (35-80)||(7039510-7039555)


Alignment Details
Target: chr4 (Bit Score: 80; Significance: 3e-38; HSPs: 8)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 80; E-Value: 3e-38
Query Start/End: Original strand, 1 - 80
Target Start/End: Complemental strand, 7004311 - 7004232
Alignment:
1 ggtagtagaagcaacaaatagatattatggttggaaacctggagatttatcaatggttggtgacctttttcatttcctgt 80  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
7004311 ggtagtagaagcaacaaatagatattatggttggaaacctggagatttatcaatggttggtgacctttttcatttcctgt 7004232  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 68; E-Value: 5e-31
Query Start/End: Original strand, 1 - 80
Target Start/End: Complemental strand, 7027135 - 7027056
Alignment:
1 ggtagtagaagcaacaaatagatattatggttggaaacctggagatttatcaatggttggtgacctttttcatttcctgt 80  Q
    |||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||    
7027135 ggtagtagaagcaacaaatagagattatggttggaaacctggagatttatcaatggctggagacctttttcatttcctgt 7027056  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 68; E-Value: 5e-31
Query Start/End: Original strand, 1 - 80
Target Start/End: Complemental strand, 7046923 - 7046844
Alignment:
1 ggtagtagaagcaacaaatagatattatggttggaaacctggagatttatcaatggttggtgacctttttcatttcctgt 80  Q
    |||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||    
7046923 ggtagtagaagcaacaaatagagattatgattggaaacctggagatttatcaatggttggtgaccttcttcatttcctgt 7046844  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 43; E-Value: 4e-16
Query Start/End: Original strand, 6 - 80
Target Start/End: Complemental strand, 7013827 - 7013753
Alignment:
6 tagaagcaacaaatagatattatggttggaaacctggagatttatcaatggttggtgacctttttcatttcctgt 80  Q
    ||||||||||  | ||| ||||||||| | ||||| ||||||||||||||||||| |||||||||||||||||||    
7013827 tagaagcaactgacagagattatggttcggaaccttgagatttatcaatggttggagacctttttcatttcctgt 7013753  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 42; E-Value: 0.000000000000002
Query Start/End: Original strand, 31 - 80
Target Start/End: Complemental strand, 7052925 - 7052876
Alignment:
31 ttggaaacctggagatttatcaatggttggtgacctttttcatttcctgt 80  Q
    |||||||||||||||||||||||||||||| | |||||||||||||||||    
7052925 ttggaaacctggagatttatcaatggttggagtcctttttcatttcctgt 7052876  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 41; E-Value: 0.000000000000006
Query Start/End: Original strand, 31 - 79
Target Start/End: Complemental strand, 7020240 - 7020192
Alignment:
31 ttggaaacctggagatttatcaatggttggtgacctttttcatttcctg 79  Q
    |||||||||||||||||||||||||||||| | ||||||||||||||||    
7020240 ttggaaacctggagatttatcaatggttggagtcctttttcatttcctg 7020192  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 38; E-Value: 0.0000000000004
Query Start/End: Original strand, 27 - 80
Target Start/End: Complemental strand, 6994371 - 6994318
Alignment:
27 atggttggaaacctggagatttatcaatggttggtgacctttttcatttcctgt 80  Q
    |||||| | ||||| ||||||||||||||||||| |||||||||||||||||||    
6994371 atggtttggaaccttgagatttatcaatggttggagacctttttcatttcctgt 6994318  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 34; E-Value: 0.00000000009
Query Start/End: Original strand, 35 - 80
Target Start/End: Complemental strand, 7039555 - 7039510
Alignment:
35 aaacctggagatttatcaatggttggtgacctttttcatttcctgt 80  Q
    ||||||||||||||||||||||| || | |||||||||||||||||    
7039555 aaacctggagatttatcaatggtaggagtcctttttcatttcctgt 7039510  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 2200 times since January 2019
Visitors: 845