View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1883-3-Insertion-10 (Length: 80)
Name: NF1883-3-Insertion-10
Description: 454-NF1883-3
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1883-3-Insertion-10 |
 |  |
|
[»] chr4 (8 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 80; Significance: 3e-38; HSPs: 8)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 80; E-Value: 3e-38
Query Start/End: Original strand, 1 - 80
Target Start/End: Complemental strand, 7004311 - 7004232
Alignment:
Q |
1 |
ggtagtagaagcaacaaatagatattatggttggaaacctggagatttatcaatggttggtgacctttttcatttcctgt |
80 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
7004311 |
ggtagtagaagcaacaaatagatattatggttggaaacctggagatttatcaatggttggtgacctttttcatttcctgt |
7004232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 68; E-Value: 5e-31
Query Start/End: Original strand, 1 - 80
Target Start/End: Complemental strand, 7027135 - 7027056
Alignment:
Q |
1 |
ggtagtagaagcaacaaatagatattatggttggaaacctggagatttatcaatggttggtgacctttttcatttcctgt |
80 |
Q |
|
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||| |
|
|
T |
7027135 |
ggtagtagaagcaacaaatagagattatggttggaaacctggagatttatcaatggctggagacctttttcatttcctgt |
7027056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 68; E-Value: 5e-31
Query Start/End: Original strand, 1 - 80
Target Start/End: Complemental strand, 7046923 - 7046844
Alignment:
Q |
1 |
ggtagtagaagcaacaaatagatattatggttggaaacctggagatttatcaatggttggtgacctttttcatttcctgt |
80 |
Q |
|
|
|||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
T |
7046923 |
ggtagtagaagcaacaaatagagattatgattggaaacctggagatttatcaatggttggtgaccttcttcatttcctgt |
7046844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 43; E-Value: 4e-16
Query Start/End: Original strand, 6 - 80
Target Start/End: Complemental strand, 7013827 - 7013753
Alignment:
Q |
6 |
tagaagcaacaaatagatattatggttggaaacctggagatttatcaatggttggtgacctttttcatttcctgt |
80 |
Q |
|
|
|||||||||| | ||| ||||||||| | ||||| ||||||||||||||||||| ||||||||||||||||||| |
|
|
T |
7013827 |
tagaagcaactgacagagattatggttcggaaccttgagatttatcaatggttggagacctttttcatttcctgt |
7013753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 42; E-Value: 0.000000000000002
Query Start/End: Original strand, 31 - 80
Target Start/End: Complemental strand, 7052925 - 7052876
Alignment:
Q |
31 |
ttggaaacctggagatttatcaatggttggtgacctttttcatttcctgt |
80 |
Q |
|
|
|||||||||||||||||||||||||||||| | ||||||||||||||||| |
|
|
T |
7052925 |
ttggaaacctggagatttatcaatggttggagtcctttttcatttcctgt |
7052876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 41; E-Value: 0.000000000000006
Query Start/End: Original strand, 31 - 79
Target Start/End: Complemental strand, 7020240 - 7020192
Alignment:
Q |
31 |
ttggaaacctggagatttatcaatggttggtgacctttttcatttcctg |
79 |
Q |
|
|
|||||||||||||||||||||||||||||| | |||||||||||||||| |
|
|
T |
7020240 |
ttggaaacctggagatttatcaatggttggagtcctttttcatttcctg |
7020192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 38; E-Value: 0.0000000000004
Query Start/End: Original strand, 27 - 80
Target Start/End: Complemental strand, 6994371 - 6994318
Alignment:
Q |
27 |
atggttggaaacctggagatttatcaatggttggtgacctttttcatttcctgt |
80 |
Q |
|
|
|||||| | ||||| ||||||||||||||||||| ||||||||||||||||||| |
|
|
T |
6994371 |
atggtttggaaccttgagatttatcaatggttggagacctttttcatttcctgt |
6994318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 34; E-Value: 0.00000000009
Query Start/End: Original strand, 35 - 80
Target Start/End: Complemental strand, 7039555 - 7039510
Alignment:
Q |
35 |
aaacctggagatttatcaatggttggtgacctttttcatttcctgt |
80 |
Q |
|
|
||||||||||||||||||||||| || | ||||||||||||||||| |
|
|
T |
7039555 |
aaacctggagatttatcaatggtaggagtcctttttcatttcctgt |
7039510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University