View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1883-3-Insertion-11 (Length: 56)

Name: NF1883-3-Insertion-11
Description: 454-NF1883-3
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1883-3-Insertion-11
NF1883-3-Insertion-11
[»] scaffold0519 (1 HSPs)
scaffold0519 (1-56)||(3234-3289)
[»] chr8 (1 HSPs)
chr8 (1-56)||(11231164-11231219)


Alignment Details
Target: scaffold0519 (Bit Score: 56; Significance: 4e-24; HSPs: 1)
Name: scaffold0519
Description:

Target: scaffold0519; HSP #1
Raw Score: 56; E-Value: 4e-24
Query Start/End: Original strand, 1 - 56
Target Start/End: Original strand, 3234 - 3289
Alignment:
1 tatttttcttcaaaaatgaaaaagactagaaactagaataacgaaaattatggtta 56  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3234 tatttttcttcaaaaatgaaaaagactagaaactagaataacgaaaattatggtta 3289  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 56; Significance: 4e-24; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 56; E-Value: 4e-24
Query Start/End: Original strand, 1 - 56
Target Start/End: Complemental strand, 11231219 - 11231164
Alignment:
1 tatttttcttcaaaaatgaaaaagactagaaactagaataacgaaaattatggtta 56  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
11231219 tatttttcttcaaaaatgaaaaagactagaaactagaataacgaaaattatggtta 11231164  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 2189 times since January 2019
Visitors: 845