View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1883-3-Insertion-12 (Length: 74)
Name: NF1883-3-Insertion-12
Description: 454-NF1883-3
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1883-3-Insertion-12 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 70; Significance: 3e-32; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 70; E-Value: 3e-32
Query Start/End: Original strand, 1 - 74
Target Start/End: Complemental strand, 10029077 - 10029004
Alignment:
| Q |
1 |
caaacatcagcaaaagccacatctgatgaaaaacacacggcagaaaccgaaaacctgaatggaagcaacaacaa |
74 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
10029077 |
caaacatcagcaaaagccacatctgatgaaaaacacaaggcagaaaccgaaaacctgaatggaagcaacaacaa |
10029004 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2193 times since January 2019
Visitors: 845