View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1883-3-Insertion-13 (Length: 59)
Name: NF1883-3-Insertion-13
Description: 454-NF1883-3
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1883-3-Insertion-13 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 40; Significance: 0.00000000000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 40; E-Value: 0.00000000000002
Query Start/End: Original strand, 11 - 57
Target Start/End: Complemental strand, 9576688 - 9576641
Alignment:
Q |
11 |
taacctttgtcaaaaa-tataataactgtaaccaaaagttaggtctaa |
57 |
Q |
|
|
|||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
T |
9576688 |
taacctttgtcaaaaaatataataactgtaaccaaaagttaggtctaa |
9576641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University