View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1883-3-Insertion-18 (Length: 39)
Name: NF1883-3-Insertion-18
Description: 454-NF1883-3
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1883-3-Insertion-18 |
 |  |
|
[»] chr6 (3 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 39; Significance: 0.00000000000003; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 39; E-Value: 0.00000000000003
Query Start/End: Original strand, 1 - 39
Target Start/End: Complemental strand, 2597043 - 2597005
Alignment:
Q |
1 |
tacaggaagagttattgctgatgccggtagcttgacgaa |
39 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||| |
|
|
T |
2597043 |
tacaggaagagttattgctgatgccggtagcttgacgaa |
2597005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 34; E-Value: 0.00000000003
Query Start/End: Original strand, 1 - 38
Target Start/End: Complemental strand, 2569484 - 2569447
Alignment:
Q |
1 |
tacaggaagagttattgctgatgccggtagcttgacga |
38 |
Q |
|
|
||||||||||||||||||||||||||||||| |||||| |
|
|
T |
2569484 |
tacaggaagagttattgctgatgccggtagcatgacga |
2569447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 28; E-Value: 0.0000001
Query Start/End: Original strand, 1 - 36
Target Start/End: Complemental strand, 2672859 - 2672824
Alignment:
Q |
1 |
tacaggaagagttattgctgatgccggtagcttgac |
36 |
Q |
|
|
|||||||||||||||||||||||| |||||| |||| |
|
|
T |
2672859 |
tacaggaagagttattgctgatgcaggtagcatgac |
2672824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University