View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1883-3-Insertion-18 (Length: 39)

Name: NF1883-3-Insertion-18
Description: 454-NF1883-3
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1883-3-Insertion-18
NF1883-3-Insertion-18
[»] chr6 (3 HSPs)
chr6 (1-39)||(2597005-2597043)
chr6 (1-38)||(2569447-2569484)
chr6 (1-36)||(2672824-2672859)


Alignment Details
Target: chr6 (Bit Score: 39; Significance: 0.00000000000003; HSPs: 3)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 39; E-Value: 0.00000000000003
Query Start/End: Original strand, 1 - 39
Target Start/End: Complemental strand, 2597043 - 2597005
Alignment:
1 tacaggaagagttattgctgatgccggtagcttgacgaa 39  Q
    |||||||||||||||||||||||||||||||||||||||    
2597043 tacaggaagagttattgctgatgccggtagcttgacgaa 2597005  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 34; E-Value: 0.00000000003
Query Start/End: Original strand, 1 - 38
Target Start/End: Complemental strand, 2569484 - 2569447
Alignment:
1 tacaggaagagttattgctgatgccggtagcttgacga 38  Q
    ||||||||||||||||||||||||||||||| ||||||    
2569484 tacaggaagagttattgctgatgccggtagcatgacga 2569447  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 28; E-Value: 0.0000001
Query Start/End: Original strand, 1 - 36
Target Start/End: Complemental strand, 2672859 - 2672824
Alignment:
1 tacaggaagagttattgctgatgccggtagcttgac 36  Q
    |||||||||||||||||||||||| |||||| ||||    
2672859 tacaggaagagttattgctgatgcaggtagcatgac 2672824  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 2182 times since January 2019
Visitors: 845