View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1883-3-Insertion-20 (Length: 39)
Name: NF1883-3-Insertion-20
Description: 454-NF1883-3
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1883-3-Insertion-20 |
 |  |
|
| [»] chr6 (3 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 39; Significance: 0.00000000000003; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 39; E-Value: 0.00000000000003
Query Start/End: Original strand, 1 - 39
Target Start/End: Original strand, 2623330 - 2623368
Alignment:
| Q |
1 |
taccggaaaagttatcgctgatgctggtagcatgacgaa |
39 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2623330 |
taccggaaaagttatcgctgatgctggtagcatgacgaa |
2623368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 31; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 39
Target Start/End: Original strand, 2591786 - 2591824
Alignment:
| Q |
1 |
taccggaaaagttatcgctgatgctggtagcatgacgaa |
39 |
Q |
| |
|
|||||||||||| || ||||||||||||||||||||||| |
|
|
| T |
2591786 |
taccggaaaagtaattgctgatgctggtagcatgacgaa |
2591824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 28; E-Value: 0.0000001
Query Start/End: Original strand, 1 - 36
Target Start/End: Complemental strand, 33786391 - 33786356
Alignment:
| Q |
1 |
taccggaaaagttatcgctgatgctggtagcatgac |
36 |
Q |
| |
|
||||||||||||||| ||||| |||||||||||||| |
|
|
| T |
33786391 |
taccggaaaagttatagctgaagctggtagcatgac |
33786356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University