View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1883-3-Insertion-6 (Length: 168)

Name: NF1883-3-Insertion-6
Description: 454-NF1883-3
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1883-3-Insertion-6
NF1883-3-Insertion-6
[»] chr7 (1 HSPs)
chr7 (2-168)||(36330729-36330901)


Alignment Details
Target: chr7 (Bit Score: 146; Significance: 3e-77; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 146; E-Value: 3e-77
Query Start/End: Original strand, 2 - 168
Target Start/End: Original strand, 36330729 - 36330901
Alignment:
2 ccctcagcatttgcatccctctttgttccaatgtaacaatcatcgtcattctcgaactcattatcagattgtacattctcatcctaa------aaataga 95  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||      |||||||    
36330729 ccctcagcatttgcatccctctttgttccaatgtaacaatcatcgtcattctcgaactcattatcagattgtacattctcatcctaaaaatagaaataga 36330828  T
96 aatagaagggatgagttgcctgaaacatgaataattatattggcttatttgactttatcgtagtttatacata 168  Q
    ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||    
36330829 aatagaagggatgagttgcctgaaacatgaagaattatattggcttatttgactttatcgtagtttatacata 36330901  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 2187 times since January 2019
Visitors: 845