View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1883-3-Insertion-6 (Length: 168)
Name: NF1883-3-Insertion-6
Description: 454-NF1883-3
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1883-3-Insertion-6 |
 |  |
|
[»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 146; Significance: 3e-77; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 146; E-Value: 3e-77
Query Start/End: Original strand, 2 - 168
Target Start/End: Original strand, 36330729 - 36330901
Alignment:
Q |
2 |
ccctcagcatttgcatccctctttgttccaatgtaacaatcatcgtcattctcgaactcattatcagattgtacattctcatcctaa------aaataga |
95 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
T |
36330729 |
ccctcagcatttgcatccctctttgttccaatgtaacaatcatcgtcattctcgaactcattatcagattgtacattctcatcctaaaaatagaaataga |
36330828 |
T |
 |
Q |
96 |
aatagaagggatgagttgcctgaaacatgaataattatattggcttatttgactttatcgtagtttatacata |
168 |
Q |
|
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
36330829 |
aatagaagggatgagttgcctgaaacatgaagaattatattggcttatttgactttatcgtagtttatacata |
36330901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University