View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1883-3-Insertion-7 (Length: 166)
Name: NF1883-3-Insertion-7
Description: 454-NF1883-3
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1883-3-Insertion-7 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 158; Significance: 2e-84; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 158; E-Value: 2e-84
Query Start/End: Original strand, 1 - 166
Target Start/End: Complemental strand, 41463584 - 41463419
Alignment:
| Q |
1 |
catacaacttggaataccttacctctaggtacaaaccaatagcttgtcttagtgattactccaagtacaacgtttttgcaacaccttcacttactgcgtt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
41463584 |
catacaacttggaataccttacctctaggtacaaaccaatagcttgtcttagtgattactccaagtacaacgtttttgcaacaccttcacttactgtgtt |
41463485 |
T |
 |
| Q |
101 |
tgtgcacttgtcgtctgtctgtgatttggttgatactgttaacgtgccggttcaatcgccgttttt |
166 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
41463484 |
tgtgcacttgtcgtctgtctgtgatttggttgataccgttaacgtgccggttcaatcgccgttttt |
41463419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University