View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1883-3-Insertion-9 (Length: 141)

Name: NF1883-3-Insertion-9
Description: 454-NF1883-3
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1883-3-Insertion-9
NF1883-3-Insertion-9
[»] chr4 (2 HSPs)
chr4 (25-141)||(13765831-13765947)
chr4 (16-48)||(14153195-14153227)


Alignment Details
Target: chr4 (Bit Score: 109; Significance: 3e-55; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 109; E-Value: 3e-55
Query Start/End: Original strand, 25 - 141
Target Start/End: Original strand, 13765831 - 13765947
Alignment:
Q  25 gcaaacaagtctcttaatagagaatagcgatgtctgtagtcttggggttgtcctatcagagttagagttactcacaggatagaaatcactatctttttac 124  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||    
T  13765831 gcaaacaagtctcttaatagagaatagcgatgtctgtagtcttggggttgtcctagctgagttagagttactcacaggatagaaatcactatctttttac 13765930  T
Q  125 aggctattggtataaag 141  Q
    |||||||||||||||||    
T  13765931 aggctattggtataaag 13765947  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 16 - 48
Target Start/End: Complemental strand, 14153227 - 14153195
Alignment:
Q  16 agaatacttgcaaacaagtctcttaatagagaa 48  Q
    ||||||||||||||||||| |||||||||||||    
T  14153227 agaatacttgcaaacaagtgtcttaatagagaa 14153195  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University