View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1883-Insertion-24 (Length: 203)
Name: NF1883-Insertion-24
Description: NF1883
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1883-Insertion-24 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 164; Significance: 7e-88; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 164; E-Value: 7e-88
Query Start/End: Original strand, 8 - 203
Target Start/End: Original strand, 36780690 - 36780885
Alignment:
| Q |
8 |
taatattgtttcatgaaccaaatcaattgaatcagaattgaaattaaatttgttaactcaatgagttgagtttaaactatatagctcacattgttttgtt |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||| ||||||||||||| ||||||||||| |||||| |||||||||||||||||||||||||||||| |
|
|
| T |
36780690 |
taatattgtttcatgaaccaaatcaattgaaccagagttgaaattaaattcgttaactcaataagttgaatttaaactatatagctcacattgttttgtt |
36780789 |
T |
 |
| Q |
108 |
catgaatcgactcgattagatttacatgtacacaagtgtgtgtttaaaaatagaagatgttttaaggatagtctaaattgaaattgtagaattatg |
203 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
36780790 |
catgaatcgactcgattatatttacatgtacataagtgtgtgtttaaaaatagaagatgttttaaagatagtctaaattgaaattgtagaattatg |
36780885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University