View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1883-Insertion-25 (Length: 70)
Name: NF1883-Insertion-25
Description: NF1883
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1883-Insertion-25 |
 |  |
|
[»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 63; Significance: 4e-28; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 63; E-Value: 4e-28
Query Start/End: Original strand, 8 - 70
Target Start/End: Original strand, 24850170 - 24850232
Alignment:
Q |
8 |
ctaagtaaatttatttgtcaaaattcaaaaattagtagaaacacagctgattctggagtggta |
70 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
24850170 |
ctaagtaaatttatttgtcaaaattcaaaaattagtagaaacacagctgattctggagtggta |
24850232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University