View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18830_high_4 (Length: 345)
Name: NF18830_high_4
Description: NF18830
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18830_high_4 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 304; Significance: 1e-171; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 304; E-Value: 1e-171
Query Start/End: Original strand, 10 - 329
Target Start/End: Original strand, 45411982 - 45412301
Alignment:
| Q |
10 |
ataatactaacaaggtttccttttattgttttaggcatgcctgctgggcaaattcttattcttgcacaatgctgaaatgtgatggcccaaaaaggaaaat |
109 |
Q |
| |
|
|||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45411982 |
ataatattaacaaggttcccttttattgttttaggcatgcctgctgggcaaattcttattcttgcacaatgctgaaatgtgatggcccaaaaaggaaaat |
45412081 |
T |
 |
| Q |
110 |
atcgtgctaatttcagcgctagtcataaatatgttttgtcctaaaatcgtttacagtaatatgttttggccaaagataatcaggccgtaagtcagaagat |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45412082 |
atcgtgctaatttcagcgctagtcataaatatgttttgtcctaaaatcgtttacagtaatatgttttggccaaagataatcaggccgtaagtcagaagat |
45412181 |
T |
 |
| Q |
210 |
attattttattcatcacttgttttgtacctttttatttcgcacgctacattttatgacaaaagttcttgtcaaacaaatgttctctccttgcattttgtt |
309 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45412182 |
attattttattcatcacttgttttgtacctttttatttcgcacgctacattttataaccaaagttcttgtcaaacaaatgttctctccttgcattttgtt |
45412281 |
T |
 |
| Q |
310 |
atgaactcatgataccactg |
329 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
45412282 |
atgaactcatgataccactg |
45412301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University