View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18830_low_6 (Length: 268)
Name: NF18830_low_6
Description: NF18830
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18830_low_6 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 101; Significance: 4e-50; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 147 - 251
Target Start/End: Complemental strand, 43800159 - 43800055
Alignment:
| Q |
147 |
attttaggtttaatttcgttcggttcaagttgcaaccttggtattattgcagttgtttttcctttttatttctccacattatttaatcaattatgctaca |
246 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43800159 |
attttaagtttaatttcgttcggttcaagttgcaaccttggtattattgcagttgtttttcctttttatttctccacattatttaatcaattatgctaca |
43800060 |
T |
 |
| Q |
247 |
ctatt |
251 |
Q |
| |
|
||||| |
|
|
| T |
43800059 |
ctatt |
43800055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University