View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18830_low_7 (Length: 250)
Name: NF18830_low_7
Description: NF18830
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18830_low_7 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 22 - 245
Target Start/End: Original strand, 11477551 - 11477774
Alignment:
| Q |
22 |
cttgcatcacaaggtcgttgtcatcgacttgtttcagttggattttggagaaaagcatgctttggagacgtgtccagaagaaccatatcatgctttgttc |
121 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11477551 |
cttgcatcacacggtcgttgtcatcgacttgtttcagttggattttggagaagagcatgctttggagacgtgtccagaagaaccatatcatgctttgttc |
11477650 |
T |
|
| Q |
122 |
tgaccaactgtgagtgtagagcttttcgcggattatagtgtcgcatactttttgtacttgatctcgcttgttgctttttcctacgtataccatctctagc |
221 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11477651 |
tgaccagctgtgagtgtagagcttttcgcggattatagtgtcgcatactttttgtacttgatctcgcttgttgctttttcctacgtataccatctctaga |
11477750 |
T |
|
| Q |
222 |
ggtgtacgtgtcgcctatgctact |
245 |
Q |
| |
|
|||||||||||||||| ||||||| |
|
|
| T |
11477751 |
ggtgtacgtgtcgcctgtgctact |
11477774 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University