View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18833_high_13 (Length: 234)
Name: NF18833_high_13
Description: NF18833
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18833_high_13 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 10 - 219
Target Start/End: Complemental strand, 19500667 - 19500469
Alignment:
| Q |
10 |
ttaggcattctcatccttgtgccacgtctaggctccatgatgtaaggattctgtgccaagtgtccttttccctcttgaggtgtagatattccaattgtac |
109 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
19500667 |
ttaggcattctcatc-ttgtgccacgtctaggctccatgatgtaaggattctgtgccaagtgtccttttccctcttgaggtgtagatatttcaattgtac |
19500569 |
T |
 |
| Q |
110 |
cggtgtccccgcttacttcagtgtccccccactcataacacaccgcgtaaccagagcgacatcctccagctcctttgacttgaaaagaacacgaagatgc |
209 |
Q |
| |
|
| ||||||| ||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19500568 |
caatgtccccacttacttcagtgt----------ataacacaccgcgtaagcagagcgacatcctccagctcctttgacttgaaaagaacacgaagatgc |
19500479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University