View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18833_high_15 (Length: 228)
Name: NF18833_high_15
Description: NF18833
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18833_high_15 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 194; Significance: 1e-105; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 15 - 212
Target Start/End: Original strand, 32702398 - 32702595
Alignment:
| Q |
15 |
atcacagaaggaaaaatcagaaacatggtccataatgtcttaatttataccagatcataatgtctagaaatgttccttctagcctgtgtgagagtatttt |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32702398 |
atcacagaaggaaaaatcagaaacatggtccataatgtcttaatttataccagatcataatgtctagaaatgttccttctagcctgtgtgagagtatttt |
32702497 |
T |
 |
| Q |
115 |
tccttgaaacatggtccatgaagaactttgcagatgtcaaaccggctgtaaataaaattggtgtccaccaacccctaaagacacatgagaatagttgg |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32702498 |
tccttgaaacatggtccatgaagaactttgcagatgtcaaaccggccgtaaataaaattggtgtccaccaacccctaaagacacatgagaatagttgg |
32702595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 59 - 194
Target Start/End: Complemental strand, 16810961 - 16810826
Alignment:
| Q |
59 |
ttataccagatcataatgtctagaaatgttccttctagcctgtgtgagagtatttttccttgaaacatggtccatgaagaactttgcagatgtcaaaccg |
158 |
Q |
| |
|
|||||||||||||||||| |||||||||| || | ||| ||||||| ||||||||| ||||||||||| | ||||||||||||||||||| ||||| |
|
|
| T |
16810961 |
ttataccagatcataatgcatagaaatgtttctgcgagcttgtgtgacagtattttttcttgaaacatgcttgatgaagaactttgcagatgctaaacca |
16810862 |
T |
 |
| Q |
159 |
gctgtaaataaaattggtgtccaccaacccctaaag |
194 |
Q |
| |
|
|||||||| |||| ||| |||||||| ||||||||| |
|
|
| T |
16810861 |
gctgtaaagaaaactggagtccaccatcccctaaag |
16810826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University