View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18834_high_1 (Length: 338)
Name: NF18834_high_1
Description: NF18834
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18834_high_1 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 223; Significance: 1e-123; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 20 - 294
Target Start/End: Original strand, 44368294 - 44368559
Alignment:
| Q |
20 |
cacgcaaaacatgggatggattactaagcattgtattcggactgtgtcattatccataacccataattagtgattaataattatccgggtagggaaaaca |
119 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
44368294 |
cacgcaaaacatgtgatggattactaagcattgtattcggactgtgtcattatccataacccatacc---------ataattatccgggtagggaaaaca |
44368384 |
T |
 |
| Q |
120 |
tttttcttgaatttaatttattccagataattaatgagataaattgggaagggatggaaattagtggaccttattaattgccaataggggtacgagattg |
219 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44368385 |
tttttcttgaatttaatttattcctgataattaatgagataaattgggaagggatggaaattagtggaccttattaattgccaataggggtacgagattg |
44368484 |
T |
 |
| Q |
220 |
atattttatgttaacaaaccattgtgagctgaatattcaattggttgatgtgacaaatcagaaaaagataatgct |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44368485 |
atattttatgttaacaaaccattgtgagctgaataatcaattggttgatgtgacaaatcagaaaaagataatgct |
44368559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 284 - 330
Target Start/End: Original strand, 44368577 - 44368621
Alignment:
| Q |
284 |
aagataatgctaaaaaacaaacttgggtgtgttagactattcttctc |
330 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
44368577 |
aagataatgctaaaaaacaaacttgg--gtgttagactattcttctc |
44368621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University