View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18835_low_3 (Length: 253)
Name: NF18835_low_3
Description: NF18835
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18835_low_3 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 75; Significance: 1e-34; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 154 - 236
Target Start/End: Original strand, 12620566 - 12620648
Alignment:
| Q |
154 |
gcaatgttaaatgctgctagatctttaaaacccatacctccattgttcttatgcatcgataatttttcccatgacaagcaatg |
236 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12620566 |
gcaacgttaaatgctgctagatctttaaaacccatacctctattgttcttatgcatcgataatttttcccatgacaagcaatg |
12620648 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 172 - 224
Target Start/End: Complemental strand, 44493728 - 44493676
Alignment:
| Q |
172 |
agatctttaaaacccatacctccat-tgttcttatgcatcgataatttttccca |
224 |
Q |
| |
|
||||||||||||||||| || |||| |||| ||||||||||||||||||||||| |
|
|
| T |
44493728 |
agatctttaaaacccatgccaccatgtgtt-ttatgcatcgataatttttccca |
44493676 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University