View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18836_high_21 (Length: 284)
Name: NF18836_high_21
Description: NF18836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18836_high_21 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 97; Significance: 1e-47; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 126 - 280
Target Start/End: Original strand, 5689624 - 5689782
Alignment:
| Q |
126 |
ttatggtccaaaa-caatgatgacaaccataaggtacttttgcatcannnnnnnnccttgtcatattcaaacaactactcattccaagcattatgcaaaa |
224 |
Q |
| |
|
|||||||||||| ||||||||||||||| | ||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
5689624 |
ttatggtccaaattcaatgatgacaaccacatggtacttttgcatcattttttttccttgtcatattcaaacaactactcataccaagcattatgcaaaa |
5689723 |
T |
 |
| Q |
225 |
agaaaaatctccattacaaaatc---catcaaaccacttattatttctccactaaacaa |
280 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
5689724 |
agaaaaatctccattacaaaatcaatcatcaaaccacttattatttctccactaaacaa |
5689782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University