View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18836_high_31 (Length: 224)

Name: NF18836_high_31
Description: NF18836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18836_high_31
NF18836_high_31
[»] chr1 (2 HSPs)
chr1 (152-208)||(51229988-51230044)
chr1 (33-65)||(51230131-51230163)


Alignment Details
Target: chr1 (Bit Score: 53; Significance: 1e-21; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 152 - 208
Target Start/End: Complemental strand, 51230044 - 51229988
Alignment:
152 aagattagctgtggtgattctctatgatatgatgatgcacctaatatatgtaagata 208  Q
    ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||    
51230044 aagattagctgtggtgattctctttgatatgatgatgcacctaatatatgtaagata 51229988  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 33 - 65
Target Start/End: Complemental strand, 51230163 - 51230131
Alignment:
33 gggagtaatttcgactatttcttagccgtcaat 65  Q
    |||||||||||||||||||||||||||||||||    
51230163 gggagtaatttcgactatttcttagccgtcaat 51230131  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University