View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18836_high_31 (Length: 224)
Name: NF18836_high_31
Description: NF18836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18836_high_31 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 53; Significance: 1e-21; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 152 - 208
Target Start/End: Complemental strand, 51230044 - 51229988
Alignment:
| Q |
152 |
aagattagctgtggtgattctctatgatatgatgatgcacctaatatatgtaagata |
208 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
51230044 |
aagattagctgtggtgattctctttgatatgatgatgcacctaatatatgtaagata |
51229988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 33 - 65
Target Start/End: Complemental strand, 51230163 - 51230131
Alignment:
| Q |
33 |
gggagtaatttcgactatttcttagccgtcaat |
65 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
51230163 |
gggagtaatttcgactatttcttagccgtcaat |
51230131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University