View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18836_high_32 (Length: 211)
Name: NF18836_high_32
Description: NF18836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18836_high_32 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 174; Significance: 8e-94; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 174; E-Value: 8e-94
Query Start/End: Original strand, 1 - 202
Target Start/End: Complemental strand, 44144799 - 44144598
Alignment:
| Q |
1 |
cgtttctttgcattgatgatgtcatggaagtaaatatttttgttgcaaaaattagataataacgcctcgttttgtaaggctatgatgtcaaattccagta |
100 |
Q |
| |
|
|||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||| |||||||||| |
|
|
| T |
44144799 |
cgtttctttgcactgatgatgtcgtggaagtaaatatttttgttgcaaaaattagataataacgccttgtttcctaaggctatgatgtcgaattccagta |
44144700 |
T |
|
| Q |
101 |
tgtacaaaactttatctggtttaatccatgtaaggagagaaacttcttgttaaattacaggccaagtaaaatttcttgcaaagcttcttctctatgatga |
200 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44144699 |
tgtacaaaactttatctggtttaatccatctaaggagagaaacttcttgttaaattacaggccaagtaaaatttcttgcaaagcttcttctctatgatga |
44144600 |
T |
|
| Q |
201 |
tg |
202 |
Q |
| |
|
|| |
|
|
| T |
44144599 |
tg |
44144598 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University