View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18836_high_4 (Length: 501)
Name: NF18836_high_4
Description: NF18836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18836_high_4 |
 |  |
|
| [»] scaffold0370 (1 HSPs) |
 |  |  |
|
| [»] scaffold0021 (2 HSPs) |
 |  |  |
|
| [»] scaffold0016 (3 HSPs) |
 |  |  |
|
| [»] scaffold0373 (1 HSPs) |
 |  |  |
|
| [»] scaffold0712 (1 HSPs) |
 |  |  |
|
| [»] scaffold0709 (1 HSPs) |
 |  |  |
|
| [»] scaffold0535 (2 HSPs) |
 |  |  |
|
| [»] scaffold0159 (2 HSPs) |
 |  |  |
|
| [»] scaffold0210 (3 HSPs) |
 |  |  |
|
| [»] scaffold0123 (2 HSPs) |
 |  |  |
|
| [»] scaffold0347 (2 HSPs) |
 |  |  |
|
| [»] scaffold0811 (3 HSPs) |
 |  |  |
|
| [»] scaffold0051 (3 HSPs) |
 |  |  |
|
| [»] scaffold0179 (2 HSPs) |
 |  |  |
|
| [»] scaffold1001 (1 HSPs) |
 |  |  |
|
| [»] scaffold0337 (1 HSPs) |
 |  |  |
|
| [»] scaffold0065 (2 HSPs) |
 |  |  |
|
| [»] scaffold0003 (3 HSPs) |
 |  |  |
|
| [»] scaffold0326 (6 HSPs) |
 |  |  |
|
| [»] scaffold0060 (2 HSPs) |
 |  |  |
|
| [»] scaffold0056 (3 HSPs) |
 |  |  |
|
| [»] scaffold0026 (3 HSPs) |
 |  |  |
|
| [»] scaffold0024 (2 HSPs) |
 |  |  |
|
| [»] scaffold0002 (3 HSPs) |
 |  |  |
|
| [»] scaffold0684 (3 HSPs) |
 |  |  |
|
| [»] scaffold0176 (1 HSPs) |
 |  |  |
|
| [»] scaffold0166 (2 HSPs) |
 |  |  |
|
| [»] scaffold0160 (1 HSPs) |
 |  |  |
|
| [»] scaffold0105 (1 HSPs) |
 |  |  |
|
| [»] scaffold0005 (4 HSPs) |
 |  |  |
|
| [»] scaffold0001 (1 HSPs) |
 |  |  |
|
| [»] scaffold0339 (1 HSPs) |
 |  |  |
|
| [»] scaffold0085 (1 HSPs) |
 |  |  |
|
| [»] scaffold0119 (1 HSPs) |
 |  |  |
|
| [»] scaffold0078 (1 HSPs) |
 |  |  |
|
| [»] scaffold0007 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: chr2 (Bit Score: 126; Significance: 9e-65; HSPs: 212)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 126; E-Value: 9e-65
Query Start/End: Original strand, 20 - 165
Target Start/End: Complemental strand, 41024615 - 41024470
Alignment:
| Q |
20 |
atcacgaacatgatcattattagtatacgggtatcaaataatctttataatatgacattctacttcatgaactgagaattgtttaaaaaattaaaattgt |
119 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41024615 |
atcacgaacatgatcattattagtatatgggtatcaaataatttttataatatgacattctacttcatgaactgagaattgtttaaaaaattaaaattgt |
41024516 |
T |
 |
| Q |
120 |
gaaactttctaatatcatagatatataagttaactttcaaacccaa |
165 |
Q |
| |
|
||||||||| ||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
41024515 |
gaaactttccaatatcatagacatataagtcaactttcaaacccaa |
41024470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 66; E-Value: 6e-29
Query Start/End: Original strand, 173 - 344
Target Start/End: Complemental strand, 38980253 - 38980085
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgtnnnnnnnnnnnnnnttgtttttggtccctgcaaaannnnnnnn |
272 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |||||||||||||| || ||||||||||||||||||||| |
|
|
| T |
38980253 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg---gtaaaaaaaaaattgtttttggtccctgcaaaattttttgt |
38980157 |
T |
 |
| Q |
273 |
nnnngaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
38980156 |
ttttgaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaatttt |
38980085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 173 - 344
Target Start/End: Original strand, 38731829 - 38731995
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgtnnnnnnnnnnnnnnttgtttttggtccctgcaaaannnnnnnn |
272 |
Q |
| |
|
||||| ||||| |||||||||||||||||||||||||| |||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
38731829 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaa-----ttgtttttggtccctgcaaaattttttgt |
38731923 |
T |
 |
| Q |
273 |
nnnngaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38731924 |
tttttaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
38731995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 179 - 344
Target Start/End: Original strand, 44985627 - 44985789
Alignment:
| Q |
179 |
aatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgtnnnnnnnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnnnnga |
278 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||| ||| ||||||||||||| ||||||| || |
|
|
| T |
44985627 |
aatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaagaat---ttgtttttggtccatgcaaaaatttttgtttttga |
44985723 |
T |
 |
| Q |
279 |
aaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
44985724 |
aaatagtccctgaccccacttttgtgatgatttgcatacgtgacacgttataactgaaccaatttt |
44985789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 173 - 344
Target Start/End: Complemental strand, 26814229 - 26814060
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgtnnnnnnnnnnnnnnttgtttttggtccctgcaaaannnnnnnn |
272 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |||||||||||||| || |||||||| |||||||||||| |
|
|
| T |
26814229 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg--gtaaaaaaaaaatttgttttttgtccctgcaaaattttttgt |
26814132 |
T |
 |
| Q |
273 |
nnnngaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
26814131 |
ttttgaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaatttt |
26814060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 173 - 344
Target Start/End: Complemental strand, 37272102 - 37271934
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgtnnnnnnnnnnnnnnttgtttttggtccctgcaaaannnnnnnn |
272 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |||||||||||||| || ||||||||||||||||||||| |
|
|
| T |
37272102 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg---gtaaaaaaaaaattgtttttggtccctgcaaaattttttgt |
37272006 |
T |
 |
| Q |
273 |
nnnngaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||| | |||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
37272005 |
ttttgaaaatagtccatgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaatttt |
37271934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 174 - 344
Target Start/End: Complemental strand, 3838263 - 3838095
Alignment:
| Q |
174 |
gctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgtnnnnnnnnnnnnnnttgtttttggtccctgcaaaannnnnnnnn |
273 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| ||| |||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
3838263 |
gctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctgtaaaaagaaaatt--ttgtttttggtccctgcaaaattttttgtt |
3838166 |
T |
 |
| Q |
274 |
nnngaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||||| || ||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
3838165 |
tttgaaaatagtccctgacaccacttttgtgatgatttgcatacgtggcacattataactgaaccaatttt |
3838095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 277 - 344
Target Start/End: Original strand, 8046430 - 8046497
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
|||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8046430 |
gaaaatagtctctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
8046497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 277 - 344
Target Start/End: Original strand, 19183884 - 19183951
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
19183884 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaatttt |
19183951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 277 - 344
Target Start/End: Original strand, 23989937 - 23990004
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
23989937 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaatttt |
23990004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 277 - 344
Target Start/End: Complemental strand, 41693901 - 41693834
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
41693901 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattacaactgaaccaatttt |
41693834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 173 - 348
Target Start/End: Complemental strand, 44073807 - 44073634
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgtnnnnnnnnnnnnnnttgtttttggtccctgcaaaannnnnnnn |
272 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |||| ||||||||| || ||||||||||||||||||||| |
|
|
| T |
44073807 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctg--gtaaaaaaaaaaattgtttttggtccctgcaaaattttttgt |
44073710 |
T |
 |
| Q |
273 |
nnnngaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttatag |
348 |
Q |
| |
|
||||||||||||| ||| |||||||||||| ||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
44073709 |
ttttgaaaatagtccctgacctcacttttgtgataatttgcatacgtgacacattataaccgaaccaattttatag |
44073634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 277 - 345
Target Start/End: Complemental strand, 5790797 - 5790729
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttta |
345 |
Q |
| |
|
||||||||||| | |||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
5790797 |
gaaaatagtccttgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaatttta |
5790729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 173 - 344
Target Start/End: Original strand, 40301975 - 40302144
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgtnnnnnnnnnnnnnnttgtttttggtccctgcaaaannnnnnnn |
272 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||| ||| |||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
40301975 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttagttttagtccctgtaaaaagaaaatt--ttgtttttggtccctgcaaaatattttgt |
40302072 |
T |
 |
| Q |
273 |
nnnngaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||| |||||||||||| |||||||||| |
|
|
| T |
40302073 |
ttttgaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactcaaccaatttt |
40302144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 277 - 344
Target Start/End: Complemental strand, 7814505 - 7814438
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
|||||||||| || |||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
7814505 |
gaaaatagtctctgaccccacttttgtgatgatttgcatacgtgtcacattataactgaaccaatttt |
7814438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 277 - 344
Target Start/End: Complemental strand, 7814638 - 7814571
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
|||||||||| || |||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
7814638 |
gaaaatagtctctgaccccacttttgtgatgatttgcatacgtgtcacattataactgaaccaatttt |
7814571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 277 - 344
Target Start/End: Complemental strand, 22881869 - 22881802
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||| |||||||||||| |||||||||| |
|
|
| T |
22881869 |
gaaaatagtccctaaccccacttttgtgatgatttgcatacgtgtcacattataactaaaccaatttt |
22881802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 277 - 344
Target Start/End: Original strand, 24483632 - 24483699
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||||| | |||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
24483632 |
gaaaatagtccctgatcccacttttgtgatgatttgcatacgtggcacattataactgaaccaatttt |
24483699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 277 - 344
Target Start/End: Complemental strand, 25954325 - 25954258
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||||| || |||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
25954325 |
gaaaatagtccctaactccacttttgtgatgatttgcatacgtaacacattataactgaaccaatttt |
25954258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 277 - 344
Target Start/End: Original strand, 40786561 - 40786628
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||| | ||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
40786561 |
gaaaatagtccatgaccccacttttgtgatgatttgcatacgtgacacattataattgaaccaatttt |
40786628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #21
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 277 - 336
Target Start/End: Original strand, 41791119 - 41791178
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaa |
336 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41791119 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaa |
41791178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #22
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 277 - 347
Target Start/End: Original strand, 12835427 - 12835497
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttata |
347 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||||||||||||| ||||||||||| |||||||||||||| |
|
|
| T |
12835427 |
gaaaatagtccctgaccctacttttgtgatgatttgcatacgtggcacattataacggaaccaattttata |
12835497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #23
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 278 - 344
Target Start/End: Complemental strand, 17541674 - 17541608
Alignment:
| Q |
278 |
aaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
|||||||||||| || ||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
17541674 |
aaaatagtccctgactccacttttgtgatgatttgcatacgtggcacattataactgaaccaatttt |
17541608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #24
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 173 - 344
Target Start/End: Original strand, 33732862 - 33733027
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgtnnnnnnnnnnnnnnttgtttttggtccctgcaaaannnnnnnn |
272 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |||||||||||||| ||| ||||||||| ||||||||||| |
|
|
| T |
33732862 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaa------ttgtttttgatccctgcaaaattttttgt |
33732955 |
T |
 |
| Q |
273 |
nnnngaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||| ||| |||| |||||| |||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
33732956 |
ttttgaaaatagttcctgaccctacttttatgatgatttgcatacgtggcacattataactgaaccaatttt |
33733027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #25
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 277 - 344
Target Start/End: Original strand, 16899996 - 16900063
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||| ||||| |||||||||||||||||||||||||||||| |||||||||||||||| |||||| |
|
|
| T |
16899996 |
gaaaataatccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacgaatttt |
16900063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #26
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 277 - 344
Target Start/End: Original strand, 16993387 - 16993454
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||| ||||| |||||||||||||||||||||||||||||| |||||||||||||||| |||||| |
|
|
| T |
16993387 |
gaaaataatccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacgaatttt |
16993454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #27
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 277 - 344
Target Start/End: Original strand, 26238912 - 26238979
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
26238912 |
gaaaatagtccctggccccacttttgtgatgatttgcatacgtggcacataataactgaaccaatttt |
26238979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #28
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 277 - 344
Target Start/End: Original strand, 26707972 - 26708039
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
26707972 |
gaaaatagtccctgaatccacttttgtgatgatttgcatacgtgacacattataactgaactaatttt |
26708039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #29
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 277 - 344
Target Start/End: Original strand, 31225817 - 31225883
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||| | |||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
31225817 |
gaaaatagtccttgaccccacttttgtgatgatttgca-acgtgacacattataactgaaccaatttt |
31225883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #30
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 277 - 344
Target Start/End: Original strand, 43710480 - 43710547
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||||| ||| |||||||||||||||||||||||||| |||||||||||||||| |||||| |
|
|
| T |
43710480 |
gaaaatagtccctgacctcacttttgtgatgatttgcatacgtggcacattataactgaacaaatttt |
43710547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #31
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 277 - 344
Target Start/End: Complemental strand, 43789090 - 43789023
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||| || ||||| |||||||||||||| |
|
|
| T |
43789090 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcatattatcactgaaccaatttt |
43789023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #32
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 278 - 344
Target Start/End: Original strand, 24483500 - 24483566
Alignment:
| Q |
278 |
aaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||| || |||||||||||||||||||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
24483500 |
aaaatagtctctgaccccacttttgtgatgatttgcatacgtgtcacatgataactgaaccaatttt |
24483566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #33
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 173 - 344
Target Start/End: Complemental strand, 11713845 - 11713676
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgtnnnnnnnnnnnnnnttgtttttggtccctgcaaaannnnnnnn |
272 |
Q |
| |
|
||||| |||| ||||||||||||||||||||||||||| |||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
11713845 |
ggctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaataatt--ttgtttttggtccctgcaaaattttttgt |
11713748 |
T |
 |
| Q |
273 |
nnnngaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||||| |||| ||||||||| ||||||||||||||| |||||||||| ||| |||||||| |
|
|
| T |
11713747 |
ttttgaaaatagtccctgacccaacttttgtggtgatttgcatacgtggcacattataattgagccaatttt |
11713676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #34
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 277 - 344
Target Start/End: Original strand, 17912550 - 17912618
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgat-gatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||||| |||||||||||||||| || ||||||||| ||||||||||||||||||||||||| |
|
|
| T |
17912550 |
gaaaatagtccctgaccccacttttgtgatagacttgcatacgggacacattataactgaaccaatttt |
17912618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #35
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 173 - 229
Target Start/End: Original strand, 22881613 - 22881669
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgt |
229 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
22881613 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccttgt |
22881669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #36
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 173 - 348
Target Start/End: Complemental strand, 29865511 - 29865340
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgtnnnnnnnnnnnnnnttgtttttggtccctgcaaaannnnnnnn |
272 |
Q |
| |
|
||||| |||||||||||||||| ||||||||||| ||| |||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
29865511 |
ggctaaaatatggttttagtccttgcaaatatgcttcgttttggttttagtccctgtaaaataaaat----ttgtttttggtccctgcaaaattttttgt |
29865416 |
T |
 |
| Q |
273 |
nnnngaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttatag |
348 |
Q |
| |
|
|||||||||| || ||| ||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
29865415 |
ttttgaaaatagtctctaaccaaacttttgtgatgatttgcatacgtgacacattaatactgaaccaattttatag |
29865340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #37
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 277 - 344
Target Start/End: Complemental strand, 1497843 - 1497776
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
1497843 |
gaaaatagtccacaaccccacttttgtgatgatttgcatacgtggtacattataactgaaccaatttt |
1497776 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #38
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 277 - 344
Target Start/End: Complemental strand, 14393029 - 14392962
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||| ||| ||| |||||||||||||||| |||||| |
|
|
| T |
14393029 |
gaaaatagtccctgaccccacttttgtgatgatttgtatatgtggcacattataactgaactaatttt |
14392962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #39
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 277 - 344
Target Start/End: Original strand, 20658160 - 20658227
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||| ||||| || ||||||||||||| ||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
20658160 |
gaaaataatccctgactccacttttgtgattatttgcatacgtggcacattataactgaaccaatttt |
20658227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #40
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 277 - 344
Target Start/End: Complemental strand, 43597400 - 43597333
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||||| |||||| ||||||||||||||||||||||||||||| || |||||||| ||||| |
|
|
| T |
43597400 |
gaaaatagtccctgaccccatttttgtgatgatttgcatacgtgacacatgatgactgaacccatttt |
43597333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #41
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 173 - 228
Target Start/End: Original strand, 43788858 - 43788913
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttg |
228 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
43788858 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccttg |
43788913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #42
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 173 - 229
Target Start/End: Complemental strand, 10671941 - 10671885
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgt |
229 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |||| |||||||||||||||||| |
|
|
| T |
10671941 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccttgt |
10671885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #43
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 16900206 - 16900154
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
16900206 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
16900154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #44
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 16993597 - 16993545
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
16993597 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
16993545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #45
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 19184151 - 19184099
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
19184151 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
19184099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #46
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 24483891 - 24483839
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
24483891 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
24483839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #47
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 37271739 - 37271791
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
37271739 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
37271791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #48
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 277 - 344
Target Start/End: Original strand, 10665084 - 10665151
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
|||||||||| || ||||||||||||||||||||| |||||||| |||||||||||||| ||||||| |
|
|
| T |
10665084 |
gaaaatagtctctgaccccacttttgtgatgatttacatacgtggtacattataactgaagcaatttt |
10665151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #49
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 277 - 344
Target Start/End: Complemental strand, 19831694 - 19831627
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
|||||||||| || | |||| |||| ||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
19831694 |
gaaaatagtcacttatcccatttttttgatgatttgcatacgtgacacattataactgaaccagtttt |
19831627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #50
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 179 - 225
Target Start/End: Complemental strand, 3671186 - 3671140
Alignment:
| Q |
179 |
aatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
3671186 |
aatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
3671140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #51
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 179 - 225
Target Start/End: Original strand, 42358705 - 42358751
Alignment:
| Q |
179 |
aatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
42358705 |
aatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
42358751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #52
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 174 - 223
Target Start/End: Original strand, 10374775 - 10374824
Alignment:
| Q |
174 |
gctagaatatggttttagtccctgcaaatatgcctcggtttggttttagt |
223 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
10374775 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
10374824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #53
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 179 - 228
Target Start/End: Original strand, 35155298 - 35155347
Alignment:
| Q |
179 |
aatatggttttagtccctgcaaatatgcctcggtttggttttagtccttg |
228 |
Q |
| |
|
||||||||||||||||||||||||||| |||| ||||||||||||||||| |
|
|
| T |
35155298 |
aatatggttttagtccctgcaaatatgtctcgttttggttttagtccttg |
35155347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #54
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 2481557 - 2481505
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
2481557 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
2481505 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #55
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 4423895 - 4423947
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
4423895 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
4423947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #56
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 5334751 - 5334803
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
5334751 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
5334803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #57
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 5335040 - 5334988
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
5335040 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
5334988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #58
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 5790558 - 5790610
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
5790558 |
ggctaaaatatggtcttagtccctgcaaatatgcctcgttttggttttagtcc |
5790610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #59
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 5790899 - 5790847
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |||| |||||||||||||| |
|
|
| T |
5790899 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
5790847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #60
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 8046329 - 8046381
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||||||||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
8046329 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtcc |
8046381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #61
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 8046648 - 8046596
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||||||||||||||| ||||||||||||| |||||||||||||| |
|
|
| T |
8046648 |
ggctaaaatatggttttagtccctacaaatatgcctcgttttggttttagtcc |
8046596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #62
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 9195206 - 9195154
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||||| |||||||||||||||||| |||||||||||||| |
|
|
| T |
9195206 |
ggctaaaatatggttttagaccctgcaaatatgcctcgttttggttttagtcc |
9195154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #63
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 11713485 - 11713537
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |||| |||||||||||||| |
|
|
| T |
11713485 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
11713537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #64
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 11788416 - 11788364
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |||| |||||||||||||| |
|
|
| T |
11788416 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
11788364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #65
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 14003742 - 14003690
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
14003742 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
14003690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #66
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 15842823 - 15842771
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
15842823 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
15842771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #67
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 16522991 - 16523043
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
16522991 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
16523043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #68
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 16523325 - 16523273
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
16523325 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
16523273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #69
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 17541382 - 17541434
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||||||||| |||||||||||||| |||||||||||||| |
|
|
| T |
17541382 |
ggctaaaatatggttttagtccccgcaaatatgcctcgttttggttttagtcc |
17541434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #70
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 19183782 - 19183834
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |||| |||||||||||||| |
|
|
| T |
19183782 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
19183834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #71
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 20131681 - 20131629
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
20131681 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
20131629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #72
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 24358616 - 24358668
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
24358616 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
24358668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #73
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 25705449 - 25705397
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
25705449 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
25705397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #74
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 26813866 - 26813918
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |||| |||||||||||||| |
|
|
| T |
26813866 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
26813918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #75
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 27311069 - 27311017
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
27311069 |
ggctaaaatatggttttagtccatgcaaatatgcctcgttttggttttagtcc |
27311017 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #76
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 29859872 - 29859820
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
29859872 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
29859820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #77
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 221
Target Start/End: Complemental strand, 33733241 - 33733193
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggtttta |
221 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
33733241 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
33733193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #78
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 36622250 - 36622302
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |||| |||||||||||||| |
|
|
| T |
36622250 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
36622302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #79
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 40302339 - 40302287
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |||| |||||||||||||| |
|
|
| T |
40302339 |
ggctaaaatatggttttagtccctgcaaatatggctcgttttggttttagtcc |
40302287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #80
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 229
Target Start/End: Complemental strand, 41694003 - 41693947
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgt |
229 |
Q |
| |
|
||||| |||||| ||||||||||||||||||||||||| |||||||||||||| ||| |
|
|
| T |
41694003 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgt |
41693947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #81
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 43592046 - 43592098
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
43592046 |
ggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtcc |
43592098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #82
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 43597154 - 43597206
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||||||||||| ||||||||||||||||| |||||||||||||| |
|
|
| T |
43597154 |
ggctaaaatatggttttagttcctgcaaatatgcctcgttttggttttagtcc |
43597206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #83
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 173 - 228
Target Start/End: Complemental strand, 17541776 - 17541721
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttg |
228 |
Q |
| |
|
||||| |||||||||||| |||||||||||||| |||| ||||||||||||||||| |
|
|
| T |
17541776 |
ggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtccttg |
17541721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #84
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 173 - 224
Target Start/End: Original strand, 23989838 - 23989889
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtc |
224 |
Q |
| |
|
||||| |||||| ||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
23989838 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtc |
23989889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #85
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 174 - 225
Target Start/End: Original strand, 29865222 - 29865273
Alignment:
| Q |
174 |
gctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
|||| |||||| ||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
29865222 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtcc |
29865273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #86
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 173 - 224
Target Start/End: Original strand, 38639412 - 38639463
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtc |
224 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |||| ||||||||||||| |
|
|
| T |
38639412 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
38639463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #87
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 179 - 225
Target Start/End: Original strand, 146332 - 146378
Alignment:
| Q |
179 |
aatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
146332 |
aatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
146378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #88
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 173 - 223
Target Start/End: Original strand, 9195054 - 9195104
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagt |
223 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |||| |||||||||||| |
|
|
| T |
9195054 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt |
9195104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #89
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 179 - 225
Target Start/End: Original strand, 15842467 - 15842513
Alignment:
| Q |
179 |
aatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
15842467 |
aatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
15842513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #90
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 173 - 219
Target Start/End: Original strand, 27310876 - 27310922
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttt |
219 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
27310876 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttt |
27310922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #91
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 179 - 225
Target Start/End: Original strand, 29859493 - 29859539
Alignment:
| Q |
179 |
aatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
29859493 |
aatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
29859539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #92
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 278 - 344
Target Start/End: Original strand, 45442415 - 45442481
Alignment:
| Q |
278 |
aaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
|||||||||||| |||||| ||||||||| ||||||||||||| ||||| || |||||||| ||||| |
|
|
| T |
45442415 |
aaaatagtccctgaccccatttttgtgattatttgcatacgtggcacatgatgactgaaccgatttt |
45442481 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #93
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 173 - 226
Target Start/End: Original strand, 4042610 - 4042663
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcct |
226 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||||||| ||||||||||||||| |
|
|
| T |
4042610 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcct |
4042663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #94
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 179 - 224
Target Start/End: Complemental strand, 17912805 - 17912760
Alignment:
| Q |
179 |
aatatggttttagtccctgcaaatatgcctcggtttggttttagtc |
224 |
Q |
| |
|
|||||||||||||| ||||||||||||||||| ||||||||||||| |
|
|
| T |
17912805 |
aatatggttttagttcctgcaaatatgcctcgttttggttttagtc |
17912760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #95
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 277 - 326
Target Start/End: Original strand, 43592146 - 43592195
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacat |
326 |
Q |
| |
|
||||||||||||| |||||| ||||||||||||||||||||||| ||||| |
|
|
| T |
43592146 |
gaaaatagtccctgaccccatttttgtgatgatttgcatacgtggcacat |
43592195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #96
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 1497610 - 1497662
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||||||||||||| ||||||||||||||| |||| ||||||||| |
|
|
| T |
1497610 |
ggctaaaatatggttttagtccttgcaaatatgcctcgttttgattttagtcc |
1497662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #97
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 3671003 - 3671055
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||||||||||||| ||||||||||||||| |||| ||||||||| |
|
|
| T |
3671003 |
ggctaaaatatggttttagtccatgcaaatatgcctcgttttgattttagtcc |
3671055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #98
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 4424185 - 4424133
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||| |||| |||||||||||||| |
|
|
| T |
4424185 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
4424133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #99
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 7814246 - 7814298
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||| ||||||||||||| |||||||||||| |||||||||||||| |
|
|
| T |
7814246 |
ggctaaaatattgttttagtccctgtaaatatgcctcgttttggttttagtcc |
7814298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #100
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 229
Target Start/End: Complemental strand, 7814737 - 7814681
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgt |
229 |
Q |
| |
|
||||| |||||| |||||||||||||||||||||||| |||||||||||||| ||| |
|
|
| T |
7814737 |
ggctaaaatatgattttagtccctgcaaatatgcctcattttggttttagtccctgt |
7814681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #101
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 221
Target Start/End: Complemental strand, 10375069 - 10375021
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggtttta |
221 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |||| |||||||||| |
|
|
| T |
10375069 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
10375021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #102
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 12835325 - 12835377
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||| |||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
12835325 |
ggctaaaatatgattttagtccctgcaaatatgcctcattttggttttagtcc |
12835377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #103
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 13215060 - 13215112
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||| |||| |||||||||||||| |
|
|
| T |
13215060 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
13215112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #104
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 14003409 - 14003461
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||| ||| |||||||||||||| |
|
|
| T |
14003409 |
ggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtcc |
14003461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #105
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 16673771 - 16673719
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||||||| ||| |||||||||| |
|
|
| T |
16673771 |
ggctaaaatatggttttggtccctgcaaatatgcctcgtttttgttttagtcc |
16673719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #106
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 18113089 - 18113141
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||||| | |||||||||||||| |
|
|
| T |
18113089 |
ggctaaaatatggttttggtccctgcaaatatgcctagttttggttttagtcc |
18113141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #107
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 20131317 - 20131369
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||| |||| |||||||||||||| |
|
|
| T |
20131317 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
20131369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #108
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 20658061 - 20658113
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| || ||||||||||||||||||||||||||| | |||||||||||||| |
|
|
| T |
20658061 |
ggctaaaacatggttttagtccctgcaaatatgccttgttttggttttagtcc |
20658113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #109
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 24358945 - 24358893
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
24358945 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
24358893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #110
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 25705085 - 25705137
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||| |||| |||||||||||||| |
|
|
| T |
25705085 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
25705137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #111
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 229
Target Start/End: Original strand, 25954115 - 25954171
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgt |
229 |
Q |
| |
|
||||| |||||| |||||||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
25954115 |
ggctaaaatatgtttttagtccctgcaaatatgtttcgttttggttttagtccttgt |
25954171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #112
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 26239160 - 26239108
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |||| |||| ||||||||| |
|
|
| T |
26239160 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtcc |
26239108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #113
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 27109073 - 27109125
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| |||||| ||||||||||||| |||||||||||||| |
|
|
| T |
27109073 |
ggctaaaatatggttttggtccctacaaatatgcctcgttttggttttagtcc |
27109125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #114
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 30215422 - 30215474
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||| ||| |||||||||||||| |
|
|
| T |
30215422 |
ggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtcc |
30215474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #115
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 221
Target Start/End: Complemental strand, 31226077 - 31226029
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggtttta |
221 |
Q |
| |
|
||||| |||||||||||| ||||||||||||||||||| |||||||||| |
|
|
| T |
31226077 |
ggctaaaatatggttttactccctgcaaatatgcctcgttttggtttta |
31226029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #116
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 33576117 - 33576065
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||| |||| |||||||||||||| |
|
|
| T |
33576117 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
33576065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #117
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 34317798 - 34317850
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||| |||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
34317798 |
ggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtcc |
34317850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #118
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 229
Target Start/End: Complemental strand, 34318083 - 34318027
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgt |
229 |
Q |
| |
|
||||| ||||||||||| |||||| ||||||||||||| |||| ||||||||||||| |
|
|
| T |
34318083 |
ggctaaaatatggttttggtccctacaaatatgcctcgttttgattttagtccttgt |
34318027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #119
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 179 - 223
Target Start/End: Complemental strand, 36622578 - 36622534
Alignment:
| Q |
179 |
aatatggttttagtccctgcaaatatgcctcggtttggttttagt |
223 |
Q |
| |
|
|||||||||||||||||||||||||||| ||| |||||||||||| |
|
|
| T |
36622578 |
aatatggttttagtccctgcaaatatgcatcgttttggttttagt |
36622534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #120
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 41451837 - 41451889
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||| |||| |||||||||||||| |
|
|
| T |
41451837 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
41451889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #121
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 41693674 - 41693726
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
41693674 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttagtcc |
41693726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #122
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 42695868 - 42695920
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||| |||| |||||||||||||| |
|
|
| T |
42695868 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
42695920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #123
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 43789192 - 43789140
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||||||||||| ||||||||||||| ||| |||||||||||||| |
|
|
| T |
43789192 |
ggctaaaatatggttttagttcctgcaaatatgcttcgttttggttttagtcc |
43789140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #124
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 44559062 - 44559114
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||| |||| |||||||||||||| |
|
|
| T |
44559062 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
44559114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #125
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 44985984 - 44985932
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||||||||| |||||||||||||| |||| |||||||||||||| |
|
|
| T |
44985984 |
ggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtcc |
44985932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #126
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 292 - 343
Target Start/End: Original strand, 3832388 - 3832439
Alignment:
| Q |
292 |
ccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattt |
343 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| || |||||||| |||| |
|
|
| T |
3832388 |
ccccacttttgtgatgatttgcacacgtgacacatgatgactgaacctattt |
3832439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #127
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 173 - 228
Target Start/End: Complemental strand, 4042890 - 4042835
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttg |
228 |
Q |
| |
|
||||| |||||||||| ||||||||||||||| |||| ||||||||||||||||| |
|
|
| T |
4042890 |
ggctaaaatatggtttaggtccctgcaaatatgtctcgttttggttttagtccttg |
4042835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #128
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 174 - 225
Target Start/End: Complemental strand, 20939324 - 20939273
Alignment:
| Q |
174 |
gctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
|||| ||||||||||| ||||||||||||||| |||| |||||||||||||| |
|
|
| T |
20939324 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
20939273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #129
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 174 - 225
Target Start/End: Original strand, 24483401 - 24483452
Alignment:
| Q |
174 |
gctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
|||| ||||||| |||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
24483401 |
gctaaaatatggctttagtccttgcaaatatgcctcgttttggttttagtcc |
24483452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #130
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 173 - 224
Target Start/End: Original strand, 31644841 - 31644892
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtc |
224 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||| |||| ||||||||||||| |
|
|
| T |
31644841 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
31644892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #131
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 292 - 343
Target Start/End: Complemental strand, 31909362 - 31909311
Alignment:
| Q |
292 |
ccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattt |
343 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| || |||||||| |||| |
|
|
| T |
31909362 |
ccccacttttgtgatgatttgcacacgtgacacatgatgactgaacccattt |
31909311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #132
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 277 - 344
Target Start/End: Original strand, 32691413 - 32691480
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
|||||| |||||| |||||| ||||||||||||||||||||||| ||| | || |||||||| ||||| |
|
|
| T |
32691413 |
gaaaatggtccctgaccccatttttgtgatgatttgcatacgtggcacgtgatgactgaacccatttt |
32691480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #133
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 292 - 343
Target Start/End: Original strand, 34317915 - 34317966
Alignment:
| Q |
292 |
ccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattt |
343 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| || |||||||| |||| |
|
|
| T |
34317915 |
ccccacttttgtgatgatttgcacacgtgacacatgatgactgaacccattt |
34317966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #134
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 173 - 224
Target Start/End: Complemental strand, 41791312 - 41791261
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtc |
224 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| ||| |||||||| |||| |
|
|
| T |
41791312 |
ggctaaaatatggttttagtccctgcaaatatgcttcgttttggtttaagtc |
41791261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #135
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 174 - 225
Target Start/End: Complemental strand, 42696202 - 42696151
Alignment:
| Q |
174 |
gctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
|||| ||||||||||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
42696202 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
42696151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #136
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 173 - 228
Target Start/End: Complemental strand, 45442696 - 45442641
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttg |
228 |
Q |
| |
|
||||| |||||| ||||||||| |||||||||| |||| ||||||||||||||||| |
|
|
| T |
45442696 |
ggctaaaatatgattttagtccttgcaaatatgtctcgttttggttttagtccttg |
45442641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #137
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 179 - 225
Target Start/End: Original strand, 1137987 - 1138033
Alignment:
| Q |
179 |
aatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||||||||| |||||||||||||||||||| ||||||||| |||| |
|
|
| T |
1137987 |
aatatggttttggtccctgcaaatatgcctcgttttggttttggtcc |
1138033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #138
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 179 - 225
Target Start/End: Complemental strand, 1497939 - 1497893
Alignment:
| Q |
179 |
aatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
|||||||||||| ||| ||||||||||||||| |||||||||||||| |
|
|
| T |
1497939 |
aatatggttttattccttgcaaatatgcctcgttttggttttagtcc |
1497893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #139
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 179 - 225
Target Start/End: Original strand, 16968558 - 16968604
Alignment:
| Q |
179 |
aatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
|||||||||||||||||| ||||||||||| | |||||||||||||| |
|
|
| T |
16968558 |
aatatggttttagtccctacaaatatgccttgttttggttttagtcc |
16968604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #140
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 179 - 229
Target Start/End: Complemental strand, 25954420 - 25954370
Alignment:
| Q |
179 |
aatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgt |
229 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| |||| ||||||||| ||| |
|
|
| T |
25954420 |
aatatggttttagtccttgcaaatatgcctcgttttgattttagtccctgt |
25954370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #141
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 179 - 225
Target Start/End: Original strand, 26238819 - 26238865
Alignment:
| Q |
179 |
aatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||||||||||||||||||||||||| |||| |||| ||||||||| |
|
|
| T |
26238819 |
aatatggttttagtccctgcaaatatgtctcgttttgattttagtcc |
26238865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #142
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 173 - 223
Target Start/End: Original strand, 31225715 - 31225765
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagt |
223 |
Q |
| |
|
||||| ||||| |||||||||||||||||||||||||| |||| ||||||| |
|
|
| T |
31225715 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttgattttagt |
31225765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #143
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 179 - 225
Target Start/End: Complemental strand, 36806890 - 36806844
Alignment:
| Q |
179 |
aatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||||||||| ||||||||||||||| |||| |||||||||||||| |
|
|
| T |
36806890 |
aatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
36806844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #144
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 173 - 223
Target Start/End: Original strand, 40124966 - 40125016
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagt |
223 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||||||| |||||||||||| |
|
|
| T |
40124966 |
ggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagt |
40125016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #145
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 179 - 225
Target Start/End: Original strand, 41791024 - 41791070
Alignment:
| Q |
179 |
aatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||||||||||||||||| ||||||||||| |||||||||||||| |
|
|
| T |
41791024 |
aatatggttttagtccctgtaaatatgcctcattttggttttagtcc |
41791070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #146
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 295 - 348
Target Start/End: Complemental strand, 5164376 - 5164323
Alignment:
| Q |
295 |
cacttttgtgatgatttgcatacgtgacacattataactgaaccaattttatag |
348 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| || |||||||| |||| |||| |
|
|
| T |
5164376 |
cacttttgtgatgatttgcacacgtgacacatgatgactgaacctatttgatag |
5164323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #147
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 179 - 224
Target Start/End: Original strand, 17912455 - 17912500
Alignment:
| Q |
179 |
aatatggttttagtccctgcaaatatgcctcggtttggttttagtc |
224 |
Q |
| |
|
|||||| |||||||||||||||||||| |||| ||||||||||||| |
|
|
| T |
17912455 |
aatatgattttagtccctgcaaatatgtctcgttttggttttagtc |
17912500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #148
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 179 - 224
Target Start/End: Complemental strand, 23990190 - 23990145
Alignment:
| Q |
179 |
aatatggttttagtccctgcaaatatgcctcggtttggttttagtc |
224 |
Q |
| |
|
|||||||||||||||| |||||||||| |||| ||||||||||||| |
|
|
| T |
23990190 |
aatatggttttagtccttgcaaatatgtctcgttttggttttagtc |
23990145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #149
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 179 - 224
Target Start/End: Complemental strand, 44559403 - 44559358
Alignment:
| Q |
179 |
aatatggttttagtccctgcaaatatgcctcggtttggttttagtc |
224 |
Q |
| |
|
||||||||||| ||||||||||||||| |||| ||||||||||||| |
|
|
| T |
44559403 |
aatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
44559358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #150
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 146690 - 146638
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||| ||| |||||||||||||| |
|
|
| T |
146690 |
ggctaaaatatggttttggtccctgcaaatatgtttcgttttggttttagtcc |
146638 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #151
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 2265397 - 2265345
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||| ||||||||| |||||||||| |||| |||||||||||||| |
|
|
| T |
2265397 |
ggctaaaatatgattttagtccttgcaaatatgtctcgttttggttttagtcc |
2265345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #152
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 3172020 - 3172072
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||| |||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
3172020 |
ggctaaaatatgattttggtccctgcaaatatgcctcattttggttttagtcc |
3172072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #153
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 3172532 - 3172480
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||| |||| |||| ||||||||||||||| |||||||||||||| |
|
|
| T |
3172532 |
ggctaaaatatgattttggtccttgcaaatatgcctcgttttggttttagtcc |
3172480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #154
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 3837933 - 3837985
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||| ||||||||||||||||||||| |||| ||| |||||||||| |
|
|
| T |
3837933 |
ggctaaaatatagttttagtccctgcaaatatgtctcgttttcgttttagtcc |
3837985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #155
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 295 - 343
Target Start/End: Complemental strand, 4042770 - 4042722
Alignment:
| Q |
295 |
cacttttgtgatgatttgcatacgtgacacattataactgaaccaattt |
343 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| || |||||||| |||| |
|
|
| T |
4042770 |
cacttttgtgatgatttgcacacgtgacacatgatgactgaacctattt |
4042722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #156
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 4794130 - 4794182
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| |||||||||||||| |||| |||||||||||||| |
|
|
| T |
4794130 |
ggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtcc |
4794182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #157
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 10664984 - 10665036
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |||| |||| | ||||||| |
|
|
| T |
10664984 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttgatattagtcc |
10665036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #158
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 10671630 - 10671682
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| |||||||||||||| |||| |||||||||||||| |
|
|
| T |
10671630 |
ggctaaaatatggttttggtccctgcaaatatatctcgttttggttttagtcc |
10671682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #159
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 291 - 343
Target Start/End: Original strand, 13850636 - 13850688
Alignment:
| Q |
291 |
accccacttttgtgatgatttgcatacgtgacacattataactgaaccaattt |
343 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| || | |||||| |||| |
|
|
| T |
13850636 |
accccacttttgtgatgatttgcacacgtgacacatgatgattgaacccattt |
13850688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #160
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 16673411 - 16673463
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||| ||| |||||||||||||| |
|
|
| T |
16673411 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtcc |
16673463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #161
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 17302143 - 17302091
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| || |||||||||||| |||| |||||||||||||| |
|
|
| T |
17302143 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggttttagtcc |
17302091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #162
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 26707873 - 26707925
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||||||||| ||||||||||||| | ||| |||||||||||||| |
|
|
| T |
26707873 |
ggctaaaatatggttttaatccctgcaaatatacttcgttttggttttagtcc |
26707925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #163
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 31325920 - 31325972
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||| |||||||||||||||||| ||| ||| |||||||||| |
|
|
| T |
31325920 |
ggctaaaatatggttctagtccctgcaaatatgcatcgttttagttttagtcc |
31325972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #164
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 278 - 326
Target Start/End: Complemental strand, 31326149 - 31326101
Alignment:
| Q |
278 |
aaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacat |
326 |
Q |
| |
|
||||||||| || |||||| ||||||||||||||||||||||| ||||| |
|
|
| T |
31326149 |
aaaatagtcgctgaccccatttttgtgatgatttgcatacgtggcacat |
31326101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #165
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 31326252 - 31326200
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||| |||||||||| ||||||||||||||| ||| |||||||||| |
|
|
| T |
31326252 |
ggctaaaatatagttttagtccttgcaaatatgcctcgttttagttttagtcc |
31326200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #166
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 32476095 - 32476147
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||||| |||||||||||||| |
|
|
| T |
32476095 |
ggctaaaatatggttttgatccctgcaaatatgcctcattttggttttagtcc |
32476147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #167
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 173 - 221
Target Start/End: Original strand, 32691313 - 32691361
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggtttta |
221 |
Q |
| |
|
||||| |||||||||||||| |||||||||||||||| |||||||||| |
|
|
| T |
32691313 |
ggctaaaatatggttttagtttctgcaaatatgcctcgttttggtttta |
32691361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #168
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 33575752 - 33575804
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| |||||||||||||| |||| |||||||||||||| |
|
|
| T |
33575752 |
ggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtcc |
33575804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #169
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 173 - 221
Target Start/End: Complemental strand, 37911120 - 37911072
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggtttta |
221 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||| ||| |||||||||| |
|
|
| T |
37911120 |
ggctaaaatatggttttggtccctgcaaatatgcttcgttttggtttta |
37911072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #170
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 40786460 - 40786512
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||||||||| || ||||||||||| |||| |||||||||||||| |
|
|
| T |
40786460 |
ggctaaaatatggttttattcactgcaaatatgtctcgttttggttttagtcc |
40786512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #171
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 449 - 489
Target Start/End: Complemental strand, 41024307 - 41024267
Alignment:
| Q |
449 |
taatcagtatcactgtctaaaataaaccgaacatagatatt |
489 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||| ||||| |
|
|
| T |
41024307 |
taatcactatcactgtctaaaataaaccgaacataaatatt |
41024267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #172
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 173 - 229
Target Start/End: Complemental strand, 43597499 - 43597443
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgt |
229 |
Q |
| |
|
||||| |||||| ||||||||||||| |||||| |||| |||||||||||||| ||| |
|
|
| T |
43597499 |
ggctaaaatatgattttagtccctgctaatatgtctcgttttggttttagtccctgt |
43597443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #173
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 43710708 - 43710656
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||| |||||| || ||||||||||||||| |||||||||||||| |
|
|
| T |
43710708 |
ggctaaaatatgattttagcccttgcaaatatgcctcgttttggttttagtcc |
43710656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #174
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 186 - 221
Target Start/End: Complemental strand, 16900135 - 16900100
Alignment:
| Q |
186 |
ttttagtccctgcaaatatgcctcggtttggtttta |
221 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||| |
|
|
| T |
16900135 |
ttttagtccctgcaaatatgcctcgttttggtttta |
16900100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #175
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 186 - 221
Target Start/End: Complemental strand, 16993526 - 16993491
Alignment:
| Q |
186 |
ttttagtccctgcaaatatgcctcggtttggtttta |
221 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||| |
|
|
| T |
16993526 |
ttttagtccctgcaaatatgcctcgttttggtttta |
16993491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #176
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 284 - 343
Target Start/End: Complemental strand, 20939216 - 20939157
Alignment:
| Q |
284 |
gtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattt |
343 |
Q |
| |
|
|||||| ||||||||||||||||||||| || ||||| ||||| || |||||||| |||| |
|
|
| T |
20939216 |
gtccctgaccccacttttgtgatgatttacacacgtggcacatgatgactgaacccattt |
20939157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #177
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 284 - 343
Target Start/End: Complemental strand, 23732220 - 23732161
Alignment:
| Q |
284 |
gtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattt |
343 |
Q |
| |
|
|||||| || ||||||||||||||||||||| ||||| ||||| || |||||||| |||| |
|
|
| T |
23732220 |
gtccctgactccacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt |
23732161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #178
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 173 - 224
Target Start/End: Complemental strand, 31909478 - 31909428
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtc |
224 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||||||| ||||||||||||| |
|
|
| T |
31909478 |
ggctaaaatatggttttggtccctgcaaatatgcctc-ttttggttttagtc |
31909428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #179
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 292 - 343
Target Start/End: Complemental strand, 34964044 - 34963993
Alignment:
| Q |
292 |
ccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattt |
343 |
Q |
| |
|
|||||||||||| |||||||||| ||||||||||| || |||||||| |||| |
|
|
| T |
34964044 |
ccccacttttgtaatgatttgcacacgtgacacatgatgactgaacccattt |
34963993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #180
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 173 - 224
Target Start/End: Original strand, 37228733 - 37228784
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtc |
224 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||| ||| ||||||||||||| |
|
|
| T |
37228733 |
ggctaaaatatggttttggtccctgcaaatatgtatcgttttggttttagtc |
37228784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #181
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 173 - 224
Target Start/End: Complemental strand, 44994061 - 44994010
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtc |
224 |
Q |
| |
|
||||| |||||||||||| |||||||||||||| |||| ||| ||||||||| |
|
|
| T |
44994061 |
ggctaaaatatggttttaatccctgcaaatatgtctcgttttagttttagtc |
44994010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #182
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 291 - 337
Target Start/End: Original strand, 1138098 - 1138144
Alignment:
| Q |
291 |
accccacttttgtgatgatttgcatacgtgacacattataactgaac |
337 |
Q |
| |
|
|||||||||||||||||||||||| ||||| ||||| || ||||||| |
|
|
| T |
1138098 |
accccacttttgtgatgatttgcacacgtggcacatgatgactgaac |
1138144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #183
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 173 - 223
Target Start/End: Complemental strand, 10665294 - 10665244
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagt |
223 |
Q |
| |
|
||||| ||||| ||||||||| |||||||||||| ||| |||||||||||| |
|
|
| T |
10665294 |
ggctaaaatatagttttagtctctgcaaatatgcatcgttttggttttagt |
10665244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #184
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 173 - 219
Target Start/End: Complemental strand, 23732328 - 23732282
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttt |
219 |
Q |
| |
|
||||| ||||||||||| ||| |||||||||||||||| |||||||| |
|
|
| T |
23732328 |
ggctaaaatatggttttggtctctgcaaatatgcctcgttttggttt |
23732282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #185
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 291 - 337
Target Start/End: Complemental strand, 25750850 - 25750804
Alignment:
| Q |
291 |
accccacttttgtgatgatttgcatacgtgacacattataactgaac |
337 |
Q |
| |
|
|||||||||||||||||||||||| ||||| ||||| || ||||||| |
|
|
| T |
25750850 |
accccacttttgtgatgatttgcacacgtggcacatgatgactgaac |
25750804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #186
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 284 - 326
Target Start/End: Original strand, 29182277 - 29182319
Alignment:
| Q |
284 |
gtccctcaccccacttttgtgatgatttgcatacgtgacacat |
326 |
Q |
| |
|
|||||| || ||||||||||||||||||||| ||||||||||| |
|
|
| T |
29182277 |
gtccctgactccacttttgtgatgatttgcacacgtgacacat |
29182319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #187
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 278 - 348
Target Start/End: Original strand, 36622349 - 36622418
Alignment:
| Q |
278 |
aaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttatag |
348 |
Q |
| |
|
|||||||||| | |||||| |||||||||||||||||||| || ||||| || || ||||| ||||||||| |
|
|
| T |
36622349 |
aaaatagtccatgaccccatttttgtgatgatttgcatac-tgccacatgatgacggaaccgattttatag |
36622418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #188
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 173 - 223
Target Start/End: Complemental strand, 36815835 - 36815785
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagt |
223 |
Q |
| |
|
||||| ||||||||||| |||| |||||||||| |||| |||||||||||| |
|
|
| T |
36815835 |
ggctaaaatatggttttggtccatgcaaatatgtctcgttttggttttagt |
36815785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #189
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 292 - 326
Target Start/End: Original strand, 42695985 - 42696019
Alignment:
| Q |
292 |
ccccacttttgtgatgatttgcatacgtgacacat |
326 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| |
|
|
| T |
42695985 |
ccccacttttgtgatgatttgcacacgtgacacat |
42696019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #190
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 173 - 223
Target Start/End: Original strand, 43671934 - 43671984
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagt |
223 |
Q |
| |
|
||||| ||||||||||| ||||||| |||||||| ||| |||||||||||| |
|
|
| T |
43671934 |
ggctaaaatatggtttttgtccctgtaaatatgcttcgttttggttttagt |
43671984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #191
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 285 - 343
Target Start/End: Complemental strand, 44559299 - 44559241
Alignment:
| Q |
285 |
tccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattt |
343 |
Q |
| |
|
||||| || |||||||| |||||||||||| ||||||||||| || |||||||| |||| |
|
|
| T |
44559299 |
tccctgactccacttttctgatgatttgcacacgtgacacatgatgactgaacccattt |
44559241 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #192
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 179 - 224
Target Start/End: Complemental strand, 3832631 - 3832586
Alignment:
| Q |
179 |
aatatggttttagtccctgcaaatatgcctcggtttggttttagtc |
224 |
Q |
| |
|
||||||||||| ||||||||||||||| ||| ||||||||||||| |
|
|
| T |
3832631 |
aatatggttttggtccctgcaaatatgtttcgttttggttttagtc |
3832586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #193
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 294 - 343
Target Start/End: Original strand, 4424014 - 4424063
Alignment:
| Q |
294 |
ccacttttgtgatgatttgcatacgtgacacattataactgaaccaattt |
343 |
Q |
| |
|
||||||||||||||||||||| ||||| ||||| || |||||||| |||| |
|
|
| T |
4424014 |
ccacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt |
4424063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #194
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 179 - 224
Target Start/End: Complemental strand, 4794467 - 4794422
Alignment:
| Q |
179 |
aatatggttttagtccctgcaaatatgcctcggtttggttttagtc |
224 |
Q |
| |
|
||||||||||| |||||| |||||||| |||| ||||||||||||| |
|
|
| T |
4794467 |
aatatggttttggtccctacaaatatgtctcgttttggttttagtc |
4794422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #195
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 300 - 344
Target Start/End: Complemental strand, 10374954 - 10374909
Alignment:
| Q |
300 |
ttgtgatgatttgcatacgtgac-acattataactgaaccaatttt |
344 |
Q |
| |
|
||||||| ||||||||||||| | |||||||||||||||||||||| |
|
|
| T |
10374954 |
ttgtgataatttgcatacgtggccacattataactgaaccaatttt |
10374909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #196
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 179 - 224
Target Start/End: Complemental strand, 13850878 - 13850833
Alignment:
| Q |
179 |
aatatggttttagtccctgcaaatatgcctcggtttggttttagtc |
224 |
Q |
| |
|
||||||||||| || ||||||||||||| ||| ||||||||||||| |
|
|
| T |
13850878 |
aatatggttttggttcctgcaaatatgcttcgttttggttttagtc |
13850833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #197
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 294 - 343
Target Start/End: Original strand, 16523108 - 16523157
Alignment:
| Q |
294 |
ccacttttgtgatgatttgcatacgtgacacattataactgaaccaattt |
343 |
Q |
| |
|
||||||||||||||||||||| ||||| ||||| || |||||||| |||| |
|
|
| T |
16523108 |
ccacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt |
16523157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #198
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 294 - 343
Target Start/End: Original strand, 27109161 - 27109210
Alignment:
| Q |
294 |
ccacttttgtgatgatttgcatacgtgacacattataactgaaccaattt |
343 |
Q |
| |
|
||||||||||||||||||||| ||||| ||||| || |||||||| |||| |
|
|
| T |
27109161 |
ccacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt |
27109210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #199
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 173 - 222
Target Start/End: Complemental strand, 34964159 - 34964110
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttag |
222 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||| |||| ||| ||||||| |
|
|
| T |
34964159 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttagttttag |
34964110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #200
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 38979889 - 38979942
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatat-gcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||||||||||||||||||||||| |||| |||||||||||||| |
|
|
| T |
38979889 |
ggctaaaatatggttttagtccctgcaaatatattctcgttttggttttagtcc |
38979942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #201
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 294 - 343
Target Start/End: Original strand, 40125085 - 40125134
Alignment:
| Q |
294 |
ccacttttgtgatgatttgcatacgtgacacattataactgaaccaattt |
343 |
Q |
| |
|
||||||||||||||||||||| ||||| ||||| || |||||||| |||| |
|
|
| T |
40125085 |
ccacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt |
40125134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #202
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 1138359 - 1138307
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| |||||||||||||| |||| ||| |||||||||| |
|
|
| T |
1138359 |
ggctaaaatatggttttgatccctgcaaatatgtctcgttttagttttagtcc |
1138307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #203
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 2481193 - 2481245
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| || | |||||||||| |||| |||||||||||||| |
|
|
| T |
2481193 |
ggctaaaatatggttttggtacttgcaaatatgtctcgttttggttttagtcc |
2481245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #204
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 297 - 337
Target Start/End: Original strand, 11788174 - 11788214
Alignment:
| Q |
297 |
cttttgtgatgatttgcatacgtgacacattataactgaac |
337 |
Q |
| |
|
|||||||||||||||||| | ||||||||| |||||||||| |
|
|
| T |
11788174 |
cttttgtgatgatttgcacatgtgacacatgataactgaac |
11788214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #205
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 173 - 221
Target Start/End: Complemental strand, 18113454 - 18113406
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggtttta |
221 |
Q |
| |
|
||||| ||||||||||| |||||| ||||||||| ||| |||||||||| |
|
|
| T |
18113454 |
ggctaaaatatggttttggtccctacaaatatgcttcgttttggtttta |
18113406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #206
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 23732039 - 23732091
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||| |||| |||||||||||||| |||| |||||||||||||| |
|
|
| T |
23732039 |
ggctaaaatatgattttgatccctgcaaatatgtctcgttttggttttagtcc |
23732091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #207
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 30215871 - 30215819
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| |||||||||||||| | || |||||||||||||| |
|
|
| T |
30215871 |
ggctaaaatatggttttggtccctgcaaatatatcgcgttttggttttagtcc |
30215819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #208
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 296 - 336
Target Start/End: Complemental strand, 36815713 - 36815673
Alignment:
| Q |
296 |
acttttgtgatgatttgcatacgtgacacattataactgaa |
336 |
Q |
| |
|
||||||||||||||||||| ||||||||||| || |||||| |
|
|
| T |
36815713 |
acttttgtgatgatttgcacacgtgacacatgatgactgaa |
36815673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #209
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 40125289 - 40125237
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||| |||| ||||||||||||||||||| ||| |||||||||| |
|
|
| T |
40125289 |
ggctaaaatatgattttggtccctgcaaatatgcctcatttttgttttagtcc |
40125237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #210
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 173 - 229
Target Start/End: Complemental strand, 43592380 - 43592324
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgt |
229 |
Q |
| |
|
||||| |||||| ||||||||||||| |||||| ||| |||| ||||||||||||| |
|
|
| T |
43592380 |
ggctaaaatatgattttagtccctgctaatatgtctcattttgattttagtccttgt |
43592324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #211
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 278 - 326
Target Start/End: Complemental strand, 44993957 - 44993909
Alignment:
| Q |
278 |
aaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacat |
326 |
Q |
| |
|
||||||||| || | |||| ||||||||||||||||||||||| ||||| |
|
|
| T |
44993957 |
aaaatagtctctgatcccatttttgtgatgatttgcatacgtggcacat |
44993909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #212
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 173 - 221
Target Start/End: Original strand, 45442316 - 45442364
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggtttta |
221 |
Q |
| |
|
||||| ||||||||||||||| ||||||||||| |||| |||| ||||| |
|
|
| T |
45442316 |
ggctaaaatatggttttagtctctgcaaatatgtctcgttttgatttta |
45442364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 70; Significance: 2e-31; HSPs: 225)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 173 - 348
Target Start/End: Original strand, 31258339 - 31258512
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgtnnnnnnnnnnnnnnttgtttttggtccctgcaaaannnnnnnn |
272 |
Q |
| |
|
||||| ||||||||||||||||||| |||||||||||| |||||||||||||| || ||||||||||||||||||||| |
|
|
| T |
31258339 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg--gtaaaaaaataatttgtttttggtccctgcaaaattttttgt |
31258436 |
T |
 |
| Q |
273 |
nnnngaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttatag |
348 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31258437 |
ttttgaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttatag |
31258512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 66; E-Value: 6e-29
Query Start/End: Original strand, 173 - 344
Target Start/End: Original strand, 18473272 - 18473440
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgtnnnnnnnnnnnnnnttgtttttggtccctgcaaaannnnnnnn |
272 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |||||||||||||| || ||||||||||||||||||||| |
|
|
| T |
18473272 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg---gtaaaaaaaaaattgtttttggtccctgcaaaattttttgt |
18473368 |
T |
 |
| Q |
273 |
nnnngaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
18473369 |
ttttgaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaatttt |
18473440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 64; E-Value: 9e-28
Query Start/End: Original strand, 277 - 344
Target Start/End: Original strand, 3679725 - 3679792
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3679725 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
3679792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 64; E-Value: 9e-28
Query Start/End: Original strand, 277 - 344
Target Start/End: Complemental strand, 15335193 - 15335126
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15335193 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
15335126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 173 - 344
Target Start/End: Complemental strand, 32454294 - 32454122
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgtnnnnnnnnnnnnnn-ttgtttttggtccctgcaaaannnnnnn |
271 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| ||||| |||||||| ||| ||||||||||||||||||||| |
|
|
| T |
32454294 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggctttagtccctgtaaaaaaaaaaaaaaattgtttttggtccctgcaaaattttttg |
32454195 |
T |
 |
| Q |
272 |
nnnnngaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32454194 |
tttttgaaaatagtccctgaccccacttttatgatgatttgcatacgtgacacattataactgaaccaatttt |
32454122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 173 - 344
Target Start/End: Complemental strand, 7001897 - 7001728
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgtnnnnnnnnnnnnnnttgtttttggtccctgcaaaannnnnnnn |
272 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |||||||||||||| || ||||||||||||||||||||| |
|
|
| T |
7001897 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg--gtaaaaaaataatttgtttttggtccctgcaaaattttttgt |
7001800 |
T |
 |
| Q |
273 |
nnnngaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||| |||||||||||| |||||||||| |
|
|
| T |
7001799 |
ttttgaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataacttaaccaatttt |
7001728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 173 - 344
Target Start/End: Original strand, 19622655 - 19622824
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc-ttgtnnnnnnnnnnnnnnttgtttttggtccctgcaaaannnnnnn |
271 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |||| |||||||||||||| |||| ||||||||||||||||||||| |
|
|
| T |
19622655 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcccttgtaaaaaaaaaat---ttgtttttggtccctgcaaaattttttg |
19622751 |
T |
 |
| Q |
272 |
nnnnngaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19622752 |
tttttgaaaatagtccatgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
19622824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 173 - 344
Target Start/End: Complemental strand, 32729049 - 32728881
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgtnnnnnnnnnnnnnnttgtttttggtccctgcaaaannnnnnnn |
272 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |||||||||||||| || ||||||||||||||||||||| |
|
|
| T |
32729049 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg---gtaaaaaaaaaattgtttttggtccctgcaaaattttttgt |
32728953 |
T |
 |
| Q |
273 |
nnnngaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||| | |||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
32728952 |
ttttgaaaatagtccatgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaatttt |
32728881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 61; E-Value: 6e-26
Query Start/End: Original strand, 173 - 344
Target Start/End: Original strand, 12361011 - 12361179
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgtnnnnnnnnnnnnnnttgtttttggtccctgcaaaannnnnnnn |
272 |
Q |
| |
|
||||| |||||||||||||||||||||||| ||||||| |||||||||||||| ||| |||||||| |||||||||||| |
|
|
| T |
12361011 |
ggctaaaatatggttttagtccctgcaaatttgcctcgttttggttttagtccctgtaaaaaaaaagt---ttgtttttcgtccctgcaaaattttttgt |
12361107 |
T |
 |
| Q |
273 |
nnnngaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
12361108 |
ttatgaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaatttt |
12361179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 61; E-Value: 6e-26
Query Start/End: Original strand, 173 - 344
Target Start/End: Complemental strand, 48956066 - 48955897
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgtnnnnnnnnnnnnnnttgtttttggtccctgcaaaannnnnnnn |
272 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||| | |||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
48956066 |
ggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccctgtaaaataaaaatt--ttgtttttggtccctgcaaaattttttgt |
48955969 |
T |
 |
| Q |
273 |
nnnngaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
|||||||||| || |||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
48955968 |
ttttgaaaatagtctctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaatttt |
48955897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 277 - 344
Target Start/End: Original strand, 990188 - 990255
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
990188 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaatttt |
990255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 277 - 344
Target Start/End: Original strand, 2733285 - 2733352
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
|||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2733285 |
gaaaatagtctctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
2733352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 277 - 348
Target Start/End: Original strand, 4323930 - 4324001
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttatag |
348 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||| |
|
|
| T |
4323930 |
gaaaatagtccctgaccccacttttgtgatgatttgtatacgtggcacattataactgaaccaattttatag |
4324001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 277 - 344
Target Start/End: Original strand, 13260087 - 13260154
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13260087 |
gaaaatagtccttgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
13260154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 277 - 344
Target Start/End: Complemental strand, 41358562 - 41358495
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
41358562 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaatttt |
41358495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 59; E-Value: 9e-25
Query Start/End: Original strand, 278 - 344
Target Start/End: Original strand, 45290559 - 45290625
Alignment:
| Q |
278 |
aaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45290559 |
aaaatagtctctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
45290625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 173 - 344
Target Start/End: Original strand, 14007489 - 14007655
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgtnnnnnnnnnnnnnnttgtttttggtccctgcaaaannnnnnnn |
272 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |||| |||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
14007489 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaa-----ttgtttttggtccctgcaaaatttttagt |
14007583 |
T |
 |
| Q |
273 |
nnnngaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||| ||||||| ||||||||||||||| ||||||| |
|
|
| T |
14007584 |
ttttgaaaatagtccctgaccccacttttgtgatgatttgtatacgtggcacattataactgaatcaatttt |
14007655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 173 - 344
Target Start/End: Complemental strand, 35308111 - 35307942
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgtnnnnnnnnnnnnnnttgtttttggtccctgcaaaannnnnnnn |
272 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |||||||||||||| ||| ||||||||||||||| ||||| |
|
|
| T |
35308111 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaagaaaatt--ttgtttttggtcccttcaaaattttttgt |
35308014 |
T |
 |
| Q |
273 |
nnnngaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||||| || ||||||||| ||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
35308013 |
ttttgaaaatagtccctgacaccacttttgcgatgatttgcatacgtggcacattataactgaaccaatttt |
35307942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 277 - 344
Target Start/End: Complemental strand, 17984595 - 17984528
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||| | | |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17984595 |
gaaaatagttcatgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
17984528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #20
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 277 - 344
Target Start/End: Complemental strand, 21391276 - 21391210
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21391276 |
gaaaatagtccctgaccc-acttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
21391210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #21
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 278 - 344
Target Start/End: Original strand, 24649452 - 24649518
Alignment:
| Q |
278 |
aaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||| || |||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
24649452 |
aaaatagtctctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaatttt |
24649518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #22
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 173 - 344
Target Start/End: Complemental strand, 44641432 - 44641267
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgtnnnnnnnnnnnnnnttgtttttggtccctgcaaaannnnnnnn |
272 |
Q |
| |
|
||||| |||||| ||||||||||||||||||||||||| |||||||||||||| ||| |||||||||||||||| |||| |
|
|
| T |
44641432 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaa-----ttgtttttggtccctgtaaaattttttgt |
44641338 |
T |
 |
| Q |
273 |
nnnngaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
44641337 |
ttttgaaaatagtccctgaccc-acttttgtgatgatttgcatacgtggcacattataactgaaccaatttt |
44641267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #23
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 277 - 344
Target Start/End: Original strand, 21383203 - 21383270
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||||| |||||||||||||||| ||||||||| ||| ||||||||||||||||||||||| |
|
|
| T |
21383203 |
gaaaatagtccctaaccccacttttgtgattatttgcatatgtggcacattataactgaaccaatttt |
21383270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #24
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 277 - 344
Target Start/End: Complemental strand, 32626792 - 32626725
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||| |||||||| |||| |||||||||||||||||| |
|
|
| T |
32626792 |
gaaaatagtccctgaccccacttttgtgatgatttacatacgtggcacaatataactgaaccaatttt |
32626725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #25
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 277 - 344
Target Start/End: Original strand, 34383047 - 34383114
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
|||||||||| | ||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
34383047 |
gaaaatagtcattgaccccacttttgtgatgatttgcatacgtgacacattataacttaaccaatttt |
34383114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #26
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 277 - 344
Target Start/End: Original strand, 41881195 - 41881262
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||| ||| |||||||||||| |||||||||| |
|
|
| T |
41881195 |
gaaaatagtccctgaccccacttttgtgatgatttgcatatgtggcacattataacttaaccaatttt |
41881262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #27
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 278 - 348
Target Start/End: Original strand, 4360370 - 4360440
Alignment:
| Q |
278 |
aaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttatag |
348 |
Q |
| |
|
|||||||||||| ||| |||||||||| ||||||||||||||| | ||||||||||||||||||||||||| |
|
|
| T |
4360370 |
aaaatagtccctgaccgcacttttgtgctgatttgcatacgtggcgcattataactgaaccaattttatag |
4360440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #28
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 278 - 344
Target Start/End: Complemental strand, 18302281 - 18302215
Alignment:
| Q |
278 |
aaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||| || || ||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
18302281 |
aaaatagtctctgactccacttttgtgatgatttgcatacgtggcacattataactgaaccaatttt |
18302215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #29
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 278 - 344
Target Start/End: Complemental strand, 29688330 - 29688264
Alignment:
| Q |
278 |
aaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||| || |||||||||||||||||||||||||||||| |||||||||||||||||| |||| |
|
|
| T |
29688330 |
aaaatagtcactgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccattttt |
29688264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #30
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 173 - 344
Target Start/End: Original strand, 26061956 - 26062125
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgtnnnnnnnnnnnnnnttgtttttggtccctgcaaaannnnnnnn |
272 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |||||||||||||| || || |||||||||||||||||| |
|
|
| T |
26061956 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg--gtaaaaaaaaaaattatttttggtccctgcaaaattttttgt |
26062053 |
T |
 |
| Q |
273 |
nnnngaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||| | | |||||||||||||||||||||||||||||| ||||||||||||||| ||||||| |
|
|
| T |
26062054 |
ttttgaaaatagtacatgaccccacttttgtgatgatttgcatacgtggcacattataactgaatcaatttt |
26062125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #31
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 173 - 344
Target Start/End: Complemental strand, 26442899 - 26442732
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgtnnnnnnnnnnnnnnttgtttttggtccctgcaaaannnnnnnn |
272 |
Q |
| |
|
||||| |||||||||||||||| ||||||||||||||| |||||||||||||| ||| |||||||||||||||||| || |
|
|
| T |
26442899 |
ggctaaaatatggttttagtccatgcaaatatgcctcgttttggttttagtccctgtaaaaagaaaatt--ttgtttttggtccctgcacaattttttgt |
26442802 |
T |
 |
| Q |
273 |
nnnngaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
26442801 |
ttttgaaaatagtcccacacc--acttttgtgatgatttgcatatgtgacacattataactgaaccaatttt |
26442732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #32
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 173 - 229
Target Start/End: Original strand, 11822004 - 11822060
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgt |
229 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
11822004 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccttgt |
11822060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #33
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 173 - 344
Target Start/End: Original strand, 22919684 - 22919850
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgtnnnnnnnnnnnnnnttgtttttggtccctgcaaaannnnnnnn |
272 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |||||||||||||| ||| ||||||||||||| ||||||| |
|
|
| T |
22919684 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt-----aaaaaaaaattgtttttggtccttgcaaaattttttgt |
22919778 |
T |
 |
| Q |
273 |
nnnngaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||||| |||||| ||||||||||||||||||||||| ||||| || |||||||| ||||| |
|
|
| T |
22919779 |
ttttgaaaatagtccctgaccccatttttgtgatgatttgcatacgtggcacatgatgactgaacccatttt |
22919850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #34
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 173 - 344
Target Start/End: Original strand, 26191359 - 26191526
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgtnnnnnnnnnnnnnnttgtttttggtccctgcaaaannnnnnnn |
272 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| ||| |||||||||||||||||| ||||||||||||| ||||||| |
|
|
| T |
26191359 |
ggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccttgt----aaaaaaaaaattgtttttggtccttgcaaaattttttgt |
26191454 |
T |
 |
| Q |
273 |
nnnngaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||||| |||||| ||||||||||||||||||||||| ||||| || |||||||| ||||| |
|
|
| T |
26191455 |
ttttgaaaatagtccctgaccccatttttgtgatgatttgcatacgtggcacatgatgactgaacccatttt |
26191526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #35
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 277 - 344
Target Start/End: Complemental strand, 1159739 - 1159672
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||||| ||||||||||| |||||||||||||| ||| ||| ||||||||||||||||||| |
|
|
| T |
1159739 |
gaaaatagtccctgaccccacttttatgatgatttgcatatgtggcacgttataactgaaccaatttt |
1159672 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #36
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 277 - 348
Target Start/End: Complemental strand, 7819001 - 7818930
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttatag |
348 |
Q |
| |
|
||||||||||||| ||| | | ||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
7819001 |
gaaaatagtccctgaccatattcttgtgatgatttgcatacgtggcacattataactgaaccaattttatag |
7818930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #37
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 277 - 344
Target Start/End: Complemental strand, 10552212 - 10552145
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||| || |||||||||||||||||||||||||||||| |||||||||||| |||||||||| |
|
|
| T |
10552212 |
gaaaatagtttctgaccccacttttgtgatgatttgcatacgtggcacattataacttaaccaatttt |
10552145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #38
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 173 - 228
Target Start/End: Complemental strand, 35005744 - 35005689
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttg |
228 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
35005744 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccttg |
35005689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #39
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 173 - 339
Target Start/End: Complemental strand, 50429209 - 50429047
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgtnnnnnnnnnnnnnnttgtttttggtccctgcaaaannnnnnnn |
272 |
Q |
| |
|
||||| |||||| ||||||||||||||||||||||||| |||||||||||||| ||| ||||||||||| ||||||||| |
|
|
| T |
50429209 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaaat---ttgtttttggttcctgcaaaattttttgt |
50429113 |
T |
 |
| Q |
273 |
nnnngaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaacca |
339 |
Q |
| |
|
||||||||||||| |||||||||| |||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
50429112 |
ttttgaaaatagtccctgaccccacttt-gtgatgatttgcttacgtgacacattataactgaacca |
50429047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #40
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 282 - 344
Target Start/End: Original strand, 35005491 - 35005553
Alignment:
| Q |
282 |
tagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
|||||||| |||| | ||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
35005491 |
tagtccctgaccctagttttgtgatgatttgcatacgtggcacattataactgaaccaatttt |
35005553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #41
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 278 - 344
Target Start/End: Original strand, 46868329 - 46868395
Alignment:
| Q |
278 |
aaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
|||||||||||| |||||| ||||||||||||||||||||||||||||| || |||||||| ||||| |
|
|
| T |
46868329 |
aaaatagtccctgaccccatttttgtgatgatttgcatacgtgacacatgatgactgaacccatttt |
46868395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #42
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 990379 - 990327
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
990379 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
990327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #43
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 1810927 - 1810979
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
1810927 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
1810979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #44
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 173 - 344
Target Start/End: Original strand, 13770489 - 13770657
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgtnnnnnnnnnnnnnnttgtttttggtccctgcaaaannnnnnnn |
272 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |||||||||||||| ||| ||||||||||||| ||||||| |
|
|
| T |
13770489 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaaat---ttgtttttggtccttgcaaaattttttgt |
13770585 |
T |
 |
| Q |
273 |
nnnngaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||||| |||||| ||||||||||||||||||||||| ||||| | |||||||| ||||| |
|
|
| T |
13770586 |
ttttgaaaatagtccctgaccccatttttgtgatgatttgcatacgtggcacatgacgactgaacccatttt |
13770657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #45
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 18302387 - 18302335
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
18302387 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
18302335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #46
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 18473595 - 18473543
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
18473595 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
18473543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #47
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 173 - 229
Target Start/End: Complemental strand, 26191734 - 26191678
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgt |
229 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |||| |||||||||||||||||| |
|
|
| T |
26191734 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccttgt |
26191678 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #48
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 29072497 - 29072549
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
29072497 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
29072549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #49
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 29072862 - 29072810
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
29072862 |
ggctaaaatatggttttagtccctgcaaatatgcctcgctttggttttagtcc |
29072810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #50
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 173 - 344
Target Start/End: Original strand, 33379888 - 33380055
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgtnnnnnnnnnnnnnnttgtttttggtccctgcaaaannnnnnnn |
272 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |||||||||||||| | | ||||||||||||||||||||| |
|
|
| T |
33379888 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctatgaaaaaaaaa----ttgtttttggtccctgcaaaattttttgt |
33379983 |
T |
 |
| Q |
273 |
nnnngaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
|||||||||||| |||||| ||||||||||||||||||||||| ||||| || || ||||||||||| |
|
|
| T |
33379984 |
tttttaaaatagtccctgaccccatttttgtgatgatttgcatacgtggcacatgatgaccgaaccaatttt |
33380055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #51
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 41358369 - 41358421
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
41358369 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
41358421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #52
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 45368490 - 45368542
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
45368490 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
45368542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #53
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 173 - 229
Target Start/End: Original strand, 52254183 - 52254239
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgt |
229 |
Q |
| |
|
||||| |||||||||||| ||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
52254183 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtccttgt |
52254239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #54
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 277 - 344
Target Start/End: Complemental strand, 1811170 - 1811103
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||||| || ||| ||||||||||||||||||||||||||||| || |||||||| ||||| |
|
|
| T |
1811170 |
gaaaatagtccctgactccatttttgtgatgatttgcatacgtgacacatgatgactgaacccatttt |
1811103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #55
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 174 - 225
Target Start/End: Original strand, 3753214 - 3753265
Alignment:
| Q |
174 |
gctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
3753214 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
3753265 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #56
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 174 - 225
Target Start/End: Original strand, 44641079 - 44641130
Alignment:
| Q |
174 |
gctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
44641079 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
44641130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #57
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 278 - 344
Target Start/End: Complemental strand, 18900033 - 18899967
Alignment:
| Q |
278 |
aaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
|||||||||||| |||||| ||||||||||||||||||||||| ||||| || |||||||| ||||| |
|
|
| T |
18900033 |
aaaatagtccctgaccccatttttgtgatgatttgcatacgtggcacatgatgactgaaccgatttt |
18899967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #58
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 278 - 344
Target Start/End: Complemental strand, 33067629 - 33067563
Alignment:
| Q |
278 |
aaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
|||||||||||| ||||||| |||||||||||||||||||||| ||||| || |||||||| ||||| |
|
|
| T |
33067629 |
aaaatagtccctgaccccacctttgtgatgatttgcatacgtggcacatgatgactgaacccatttt |
33067563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #59
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 173 - 223
Target Start/End: Original strand, 35307715 - 35307765
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagt |
223 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
35307715 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
35307765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #60
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 279 - 344
Target Start/End: Complemental strand, 22953454 - 22953389
Alignment:
| Q |
279 |
aaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||| ||| |||||||||||||||| ||||||||||| ||||||||| |||||||||| |
|
|
| T |
22953454 |
aaatagtccctggccctacttttgtgatgatttacatacgtgacatattataacttaaccaatttt |
22953389 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #61
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 173 - 222
Target Start/End: Original strand, 24649350 - 24649399
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttag |
222 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
24649350 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttag |
24649399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #62
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 990088 - 990140
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||||||||||||||| ||||||||||||| |||||||||||||| |
|
|
| T |
990088 |
ggctaaaatatggttttagtccctacaaatatgcctcgttttggttttagtcc |
990140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #63
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 3679626 - 3679678
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||||||||||||||| ||||||||||||| |||||||||||||| |
|
|
| T |
3679626 |
ggctaaaatatggttttagtccctacaaatatgcctcgttttggttttagtcc |
3679678 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #64
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 3753572 - 3753520
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||||||||||| |||||||||||| |||||||||||||| |
|
|
| T |
3753572 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtcc |
3753520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #65
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 6567496 - 6567444
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |||| |||||||||||||| |
|
|
| T |
6567496 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
6567444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #66
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 13260321 - 13260269
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |||| |||||||||||||| |
|
|
| T |
13260321 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
13260269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #67
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 19623017 - 19622965
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||||||||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
19623017 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtcc |
19622965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #68
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 21391096 - 21391148
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |||| |||||||||||||| |
|
|
| T |
21391096 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
21391148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #69
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 229
Target Start/End: Complemental strand, 22919977 - 22919921
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgt |
229 |
Q |
| |
|
||||| ||||||||||||||| |||||||||||||||| ||| |||||||||||||| |
|
|
| T |
22919977 |
ggctaaaatatggttttagtctctgcaaatatgcctcgttttagttttagtccttgt |
22919921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #70
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 24507843 - 24507791
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
24507843 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
24507791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #71
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 24653802 - 24653854
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
24653802 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
24653854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #72
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 26442563 - 26442615
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |||| |||||||||||||| |
|
|
| T |
26442563 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
26442615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #73
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 29688428 - 29688376
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||||||||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
29688428 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtcc |
29688376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #74
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 33045690 - 33045638
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
33045690 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
33045638 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #75
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 35005444 - 35005496
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |||| ||||||||| |
|
|
| T |
35005444 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtcc |
35005496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #76
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 37545628 - 37545680
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
37545628 |
ggctaaaatatggttttagtccatgcaaatatgcctcgttttggttttagtcc |
37545680 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #77
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 38151212 - 38151160
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
38151212 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
38151160 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #78
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 38164295 - 38164243
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
38164295 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
38164243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #79
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 45290457 - 45290509
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |||| |||||||||||||| |
|
|
| T |
45290457 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
45290509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #80
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 45290820 - 45290768
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||||||||| |||||||||||||| |||||||||||||| |
|
|
| T |
45290820 |
ggctaaaatatggttttagtccccgcaaatatgcctcgttttggttttagtcc |
45290768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #81
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 47819232 - 47819284
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
47819232 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
47819284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #82
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 47819596 - 47819544
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
47819596 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
47819544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #83
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 284 - 344
Target Start/End: Complemental strand, 48730509 - 48730449
Alignment:
| Q |
284 |
gtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
|||||| |||||||||||||||||||||||| ||||||||||| || |||||||| ||||| |
|
|
| T |
48730509 |
gtccctgaccccacttttgtgatgatttgcacacgtgacacatgatgactgaacctatttt |
48730449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #84
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 229
Target Start/End: Original strand, 48955714 - 48955770
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgt |
229 |
Q |
| |
|
||||| |||||| ||||||||||||||||||||||||| ||||||||||||| |||| |
|
|
| T |
48955714 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtctttgt |
48955770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #85
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 50799130 - 50799182
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
50799130 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtcc |
50799182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #86
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 52254479 - 52254427
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |||| ||||||||| |
|
|
| T |
52254479 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtcc |
52254427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #87
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 174 - 229
Target Start/End: Original strand, 15058419 - 15058474
Alignment:
| Q |
174 |
gctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgt |
229 |
Q |
| |
|
|||| ||||||||||| ||||||||||||||| |||| |||||||||||||||||| |
|
|
| T |
15058419 |
gctaaaatatggttttggtccctgcaaatatgactcgttttggttttagtccttgt |
15058474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #88
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 173 - 224
Target Start/End: Original strand, 17984333 - 17984384
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtc |
224 |
Q |
| |
|
||||| |||||||||| ||||||||||||||||||||| ||||||||||||| |
|
|
| T |
17984333 |
ggctaaaatatggtttgagtccctgcaaatatgcctcgttttggttttagtc |
17984384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #89
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 173 - 224
Target Start/End: Complemental strand, 17984701 - 17984650
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtc |
224 |
Q |
| |
|
||||| |||||| ||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
17984701 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtc |
17984650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #90
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 174 - 225
Target Start/End: Original strand, 44157696 - 44157747
Alignment:
| Q |
174 |
gctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
|||| ||||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
44157696 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
44157747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #91
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 173 - 224
Target Start/End: Complemental strand, 48609594 - 48609543
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtc |
224 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |||| ||||||||||||| |
|
|
| T |
48609594 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
48609543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #92
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 301 - 344
Target Start/End: Original strand, 49226361 - 49226404
Alignment:
| Q |
301 |
tgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
49226361 |
tgtgatgatttgcatacgtggcacattataactgaaccaatttt |
49226404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #93
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 179 - 225
Target Start/End: Original strand, 2939935 - 2939981
Alignment:
| Q |
179 |
aatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
|||||||||||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
2939935 |
aatatggttttaatccctgcaaatatgcctcgttttggttttagtcc |
2939981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #94
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 179 - 225
Target Start/End: Complemental strand, 3247556 - 3247510
Alignment:
| Q |
179 |
aatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
3247556 |
aatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
3247510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #95
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 174 - 224
Target Start/End: Original strand, 4323829 - 4323879
Alignment:
| Q |
174 |
gctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtc |
224 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||| |||| |||||||| |
|
|
| T |
4323829 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtc |
4323879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #96
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 278 - 344
Target Start/End: Original strand, 16083154 - 16083220
Alignment:
| Q |
278 |
aaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
|||||||||||| ||||| ||||||||||||||||||||||| ||||| || |||||||| ||||| |
|
|
| T |
16083154 |
aaaatagtccctggccccatttttgtgatgatttgcatacgtggcacatgatgactgaaccgatttt |
16083220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #97
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 179 - 225
Target Start/End: Complemental strand, 18900127 - 18900081
Alignment:
| Q |
179 |
aatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||||||||||||||||||||||||| |||| |||||||||||||| |
|
|
| T |
18900127 |
aatatggttttagtccctgcaaatatgactcgttttggttttagtcc |
18900081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #98
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 179 - 225
Target Start/End: Complemental strand, 24649654 - 24649608
Alignment:
| Q |
179 |
aatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
24649654 |
aatatggttttagtccttgcaaatatgcctcgttttggttttagtcc |
24649608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #99
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 179 - 225
Target Start/End: Complemental strand, 31258696 - 31258650
Alignment:
| Q |
179 |
aatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||| |||||||||| |
|
|
| T |
31258696 |
aatatggttttagtccctgcaaatatgcctcgtttttgttttagtcc |
31258650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #100
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 173 - 223
Target Start/End: Original strand, 32626529 - 32626579
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagt |
223 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |||| |||||||||||| |
|
|
| T |
32626529 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt |
32626579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #101
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 179 - 225
Target Start/End: Original strand, 38163937 - 38163983
Alignment:
| Q |
179 |
aatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
38163937 |
aatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
38163983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #102
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 173 - 223
Target Start/End: Complemental strand, 41358663 - 41358613
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagt |
223 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |||| |||||||||||| |
|
|
| T |
41358663 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt |
41358613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #103
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 174 - 223
Target Start/End: Original strand, 7818783 - 7818832
Alignment:
| Q |
174 |
gctagaatatggttttagtccctgcaaatatgcctcggtttggttttagt |
223 |
Q |
| |
|
|||| ||||| |||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
7818783 |
gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagt |
7818832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #104
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 284 - 337
Target Start/End: Complemental strand, 8364867 - 8364814
Alignment:
| Q |
284 |
gtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaac |
337 |
Q |
| |
|
|||||| |||||||||||||||||||||||| ||||||||||| || ||||||| |
|
|
| T |
8364867 |
gtccctgaccccacttttgtgatgatttgcacacgtgacacatgatgactgaac |
8364814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #105
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 173 - 222
Target Start/End: Complemental strand, 22953556 - 22953507
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttag |
222 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |||| ||||||||||| |
|
|
| T |
22953556 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttag |
22953507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #106
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 3247198 - 3247250
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||| |||| |||||||||||||| |
|
|
| T |
3247198 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
3247250 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #107
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 3679986 - 3679934
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||| ||||||||||||||||||||||||| |||| ||||||||| |
|
|
| T |
3679986 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttgattttagtcc |
3679934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #108
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 179 - 227
Target Start/End: Original strand, 7350429 - 7350477
Alignment:
| Q |
179 |
aatatggttttagtccctgcaaatatgcctcggtttggttttagtcctt |
227 |
Q |
| |
|
||||||||||||||||||||||||||| ||| |||||||||||||||| |
|
|
| T |
7350429 |
aatatggttttagtccctgcaaatatgtctcattttggttttagtcctt |
7350477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #109
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 8140434 - 8140486
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||| |||| |||||||||||||| |
|
|
| T |
8140434 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
8140486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #110
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 8140799 - 8140747
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| || ||||||||||||||||| |||||||||||||| |
|
|
| T |
8140799 |
ggctaaaatatggttttggtacctgcaaatatgcctcgttttggttttagtcc |
8140747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #111
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 10631164 - 10631216
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||| |||| |||||||||||||| |
|
|
| T |
10631164 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
10631216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #112
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 10631528 - 10631476
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||| |||| |||||||||||||| |
|
|
| T |
10631528 |
ggctaaaatatggttttggtccctgcaaatatggctcgttttggttttagtcc |
10631476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #113
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 10887598 - 10887546
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||| |||| |||||||||||||| |
|
|
| T |
10887598 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
10887546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #114
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 11822365 - 11822313
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |||| |||| ||||||||| |
|
|
| T |
11822365 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttgcttttagtcc |
11822313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #115
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 12158690 - 12158742
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||||||| |||||||||||| ||| |||||||||||||| |
|
|
| T |
12158690 |
ggctaaaatatggttttagtctctgcaaatatgcatcgttttggttttagtcc |
12158742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #116
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 12360968 - 12360916
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||| |||| |||||||||||||| |
|
|
| T |
12360968 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
12360916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #117
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 13259988 - 13260040
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||||||| ||||||||||| |||| |||||||||||||| |
|
|
| T |
13259988 |
ggctaaaatatggttttagtcgctgcaaatatggctcgttttggttttagtcc |
13260040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #118
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 179 - 223
Target Start/End: Complemental strand, 15335289 - 15335245
Alignment:
| Q |
179 |
aatatggttttagtccctgcaaatatgcctcggtttggttttagt |
223 |
Q |
| |
|
|||||| ||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
15335289 |
aatatgattttagtccctgcaaatatgcctcgttttggttttagt |
15335245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #119
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 15516582 - 15516634
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||||| | |||||||||||||| |
|
|
| T |
15516582 |
ggctaaaatatggttttggtccctgcaaatatgccttgttttggttttagtcc |
15516634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #120
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 15526362 - 15526310
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||| |||| |||||||||||||| |
|
|
| T |
15526362 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
15526310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #121
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 16026938 - 16026886
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
16026938 |
ggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtcc |
16026886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #122
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 16060885 - 16060833
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
16060885 |
ggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtcc |
16060833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #123
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 179 - 223
Target Start/End: Original strand, 18899845 - 18899889
Alignment:
| Q |
179 |
aatatggttttagtccctgcaaatatgcctcggtttggttttagt |
223 |
Q |
| |
|
||||||||||||||||||||||||||| |||| |||||||||||| |
|
|
| T |
18899845 |
aatatggttttagtccctgcaaatatgtctcgttttggttttagt |
18899889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #124
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 19720712 - 19720764
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||| |||| |||||||||||||| |
|
|
| T |
19720712 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
19720764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #125
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 24507479 - 24507531
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
24507479 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
24507531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #126
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 24977778 - 24977830
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||| |||| |||||||||||||| |
|
|
| T |
24977778 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
24977830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #127
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 26324585 - 26324637
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||| |||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
26324585 |
ggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtcc |
26324637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #128
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 30322929 - 30322981
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||| |||| |||||||||||||| |
|
|
| T |
30322929 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
30322981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #129
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 30323293 - 30323241
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||| |||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
30323293 |
ggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtcc |
30323241 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #130
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 33000305 - 33000357
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||||||| |||| ||||||||| |
|
|
| T |
33000305 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttgattttagtcc |
33000357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #131
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 33000669 - 33000617
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||| |||| |||||||||||||| |
|
|
| T |
33000669 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
33000617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #132
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 33234546 - 33234598
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
33234546 |
ggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtcc |
33234598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #133
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 34002940 - 34002888
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| || | |||||||||||||| |
|
|
| T |
34002940 |
ggctaaaatatggttttagtccctgcaaatatgtcttgttttggttttagtcc |
34002888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #134
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 35056530 - 35056582
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||| |||| |||||||||||||| |
|
|
| T |
35056530 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
35056582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #135
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 35056894 - 35056842
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||| |||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
35056894 |
ggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtcc |
35056842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #136
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 37624746 - 37624798
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||| |||||||||||||||||||||| ||||||||| |||| |
|
|
| T |
37624746 |
ggctaaaatatggttctagtccctgcaaatatgcctcgttttggttttggtcc |
37624798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #137
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 38136981 - 38136929
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||| |||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
38136981 |
ggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtcc |
38136929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #138
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 39747835 - 39747783
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||| |||| |||||||||||||| |
|
|
| T |
39747835 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
39747783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #139
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 40718110 - 40718162
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||| |||| |||||||||||||| |
|
|
| T |
40718110 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
40718162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #140
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 41881093 - 41881145
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||||||||||||||| |||||||| |||| |||||||||||||| |
|
|
| T |
41881093 |
ggctaaaatatggttttagtccctccaaatatgtctcgttttggttttagtcc |
41881145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #141
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 44158042 - 44157990
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||||| | |||||||||||||| |
|
|
| T |
44158042 |
ggctaaaatatggtttttgtccctgcaaatatgcctagttttggttttagtcc |
44157990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #142
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 45380272 - 45380324
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||| |||| |||||||||||||| |
|
|
| T |
45380272 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
45380324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #143
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 45380636 - 45380584
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||| |||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
45380636 |
ggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtcc |
45380584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #144
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 45638580 - 45638632
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||| ||| |||||||||||||| |
|
|
| T |
45638580 |
ggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtcc |
45638632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #145
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 46868577 - 46868525
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||||||||| |||||||||||||| |||| |||||||||||||| |
|
|
| T |
46868577 |
ggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtcc |
46868525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #146
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 48609236 - 48609288
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||||||||| ||||||||| |||| |||||||||||||| |
|
|
| T |
48609236 |
ggctaaaatatggttttagtcccggcaaatatgtctcgttttggttttagtcc |
48609288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #147
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 182 - 225
Target Start/End: Original strand, 292868 - 292911
Alignment:
| Q |
182 |
atggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||||||||||||||||||||||||||| |||| ||||||||| |
|
|
| T |
292868 |
atggttttagtccctgcaaatatgcctcgttttgcttttagtcc |
292911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #148
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 173 - 224
Target Start/End: Complemental strand, 7819103 - 7819052
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtc |
224 |
Q |
| |
|
||||| |||||||||||| || |||||||||||||||| ||||||||||||| |
|
|
| T |
7819103 |
ggctaaaatatggttttaatctctgcaaatatgcctcgttttggttttagtc |
7819052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #149
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 277 - 344
Target Start/End: Original strand, 11822104 - 11822171
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
|||| ||||| || |||||| ||||||||||||||||||||||| ||||| || |||||||| ||||| |
|
|
| T |
11822104 |
gaaagtagtctctgaccccatttttgtgatgatttgcatacgtggcacatgatgactgaacccatttt |
11822171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #150
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 277 - 344
Target Start/End: Original strand, 20756120 - 20756187
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||||| |||| | ||||||||||||||||||||||| ||||| || | |||||| ||||| |
|
|
| T |
20756120 |
gaaaatagtccctgaccctatttttgtgatgatttgcatacgtggcacatgatgattgaacccatttt |
20756187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #151
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 173 - 224
Target Start/End: Complemental strand, 26324947 - 26324896
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtc |
224 |
Q |
| |
|
||||| |||||| ||||||||| ||||||||||||||| ||||||||||||| |
|
|
| T |
26324947 |
ggctaaaatatgattttagtccatgcaaatatgcctcgttttggttttagtc |
26324896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #152
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 174 - 225
Target Start/End: Original strand, 27521577 - 27521628
Alignment:
| Q |
174 |
gctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
|||| ||||||||||||||||||||||||||| |||| |||| ||||||||| |
|
|
| T |
27521577 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtcc |
27521628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #153
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 174 - 225
Target Start/End: Original strand, 39303675 - 39303726
Alignment:
| Q |
174 |
gctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
|||| |||||||||||||||||||||| |||| |||| |||||||||||||| |
|
|
| T |
39303675 |
gctaaaatatggttttagtccctgcaagtatgtctcgttttggttttagtcc |
39303726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #154
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 179 - 225
Target Start/End: Original strand, 4789314 - 4789360
Alignment:
| Q |
179 |
aatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||||||||| ||||||||||||||| |||| |||||||||||||| |
|
|
| T |
4789314 |
aatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
4789360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #155
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 179 - 229
Target Start/End: Complemental strand, 7350730 - 7350680
Alignment:
| Q |
179 |
aatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgt |
229 |
Q |
| |
|
||||||||||| ||| |||||||||| ||||| |||||||||||||||||| |
|
|
| T |
7350730 |
aatatggttttggtcactgcaaatatacctcgttttggttttagtccttgt |
7350680 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #156
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 173 - 215
Target Start/End: Complemental strand, 18079660 - 18079618
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttg |
215 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
18079660 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttg |
18079618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #157
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 179 - 225
Target Start/End: Complemental strand, 19721068 - 19721022
Alignment:
| Q |
179 |
aatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
|||||| |||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
19721068 |
aatatgattttggtccctgcaaatatgcctcgttttggttttagtcc |
19721022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #158
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 277 - 344
Target Start/End: Original strand, 26142521 - 26142580
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
26142521 |
gaaaatagtccctgaccccacttttgtgatgatttgc--------cacattataactgaaccaatttt |
26142580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #159
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 174 - 224
Target Start/End: Original strand, 34382948 - 34382997
Alignment:
| Q |
174 |
gctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtc |
224 |
Q |
| |
|
|||| |||||||||||||||||||||||||| |||| |||||||||||||| |
|
|
| T |
34382948 |
gctaaaatatggttttagtccctgcaaatatacctc-gtttggttttagtc |
34382997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #160
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 179 - 225
Target Start/End: Original strand, 34808203 - 34808249
Alignment:
| Q |
179 |
aatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
|||||||||||||||||| |||||||| |||| |||||||||||||| |
|
|
| T |
34808203 |
aatatggttttagtcccttcaaatatgtctcgttttggttttagtcc |
34808249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #161
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 278 - 344
Target Start/End: Original strand, 34808296 - 34808362
Alignment:
| Q |
278 |
aaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||| | |||||| ||||||||||||||||||||||| ||||| || |||||||| ||||| |
|
|
| T |
34808296 |
aaaatagtcaatgaccccatttttgtgatgatttgcatacgtggcacataatgactgaacccatttt |
34808362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #162
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 278 - 344
Target Start/End: Complemental strand, 37545850 - 37545784
Alignment:
| Q |
278 |
aaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||| |||||| ||||||||| ||||||||||||| ||||| || |||||||| ||||| |
|
|
| T |
37545850 |
aaaatagtccccgaccccatttttgtgataatttgcatacgtgccacatgatgactgaacccatttt |
37545784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #163
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 179 - 225
Target Start/End: Original strand, 38150854 - 38150900
Alignment:
| Q |
179 |
aatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||||||||| ||||||||||||||| |||| |||||||||||||| |
|
|
| T |
38150854 |
aatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
38150900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #164
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 179 - 225
Target Start/End: Complemental strand, 45368843 - 45368797
Alignment:
| Q |
179 |
aatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
|||||| |||||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
45368843 |
aatatgattttagtctctgcaaatatgcctcgttttggttttagtcc |
45368797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #165
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 179 - 225
Target Start/End: Original strand, 46183690 - 46183736
Alignment:
| Q |
179 |
aatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||||||||| |||||||||||||||| ||| |||||||||||||| |
|
|
| T |
46183690 |
aatatggttttggtccctgcaaatatgcttcgttttggttttagtcc |
46183736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #166
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 278 - 344
Target Start/End: Complemental strand, 48609493 - 48609427
Alignment:
| Q |
278 |
aaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||| || |||||| ||||||||||||||||||||||| ||||| || ||| |||| ||||| |
|
|
| T |
48609493 |
aaaatagtctctgaccccatttttgtgatgatttgcatacgtggcacatgatgactaaacccatttt |
48609427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #167
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 179 - 229
Target Start/End: Complemental strand, 48730611 - 48730561
Alignment:
| Q |
179 |
aatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgt |
229 |
Q |
| |
|
||||||||||| |||| ||||||||||||||| ||| |||||||||||||| |
|
|
| T |
48730611 |
aatatggttttggtccttgcaaatatgcctcgtttttgttttagtccttgt |
48730561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #168
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 278 - 344
Target Start/End: Original strand, 52254283 - 52254349
Alignment:
| Q |
278 |
aaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
|||||||||||| |||||| |||| | |||||||||||||||| ||||| || |||||||| ||||| |
|
|
| T |
52254283 |
aaaatagtccctgaccccatttttattatgatttgcatacgtggcacatgatgactgaaccgatttt |
52254349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #169
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 179 - 224
Target Start/End: Complemental strand, 16083393 - 16083348
Alignment:
| Q |
179 |
aatatggttttagtccctgcaaatatgcctcggtttggttttagtc |
224 |
Q |
| |
|
|||||||||||||||||||||||||| ||||| |||| |||||||| |
|
|
| T |
16083393 |
aatatggttttagtccctgcaaatatacctcgttttgattttagtc |
16083348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #170
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 179 - 224
Target Start/End: Complemental strand, 21391368 - 21391323
Alignment:
| Q |
179 |
aatatggttttagtccctgcaaatatgcctcggtttggttttagtc |
224 |
Q |
| |
|
||||||||||||||||||| |||||||||||| ||| ||||||||| |
|
|
| T |
21391368 |
aatatggttttagtccctgtaaatatgcctcgttttagttttagtc |
21391323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #171
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 173 - 222
Target Start/End: Complemental strand, 24654167 - 24654118
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttag |
222 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||| |||| ||||||||||| |
|
|
| T |
24654167 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttag |
24654118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #172
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 173 - 226
Target Start/End: Original strand, 33067348 - 33067401
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcct |
226 |
Q |
| |
|
||||| |||||||||||||||| |||||||||| |||| ||||||||| ||||| |
|
|
| T |
33067348 |
ggctaaaatatggttttagtccttgcaaatatgtctcgttttggttttggtcct |
33067401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #173
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 7867129 - 7867181
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||||||||||||| |||||||||| |||| ||| |||||||||| |
|
|
| T |
7867129 |
ggctaaaatatggttttagtccttgcaaatatgtctcgttttagttttagtcc |
7867181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #174
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 10887233 - 10887285
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||| ||| |||||||||||||| |
|
|
| T |
10887233 |
ggctaaaatatggttttggtccctgcaaatatgtttcgttttggttttagtcc |
10887285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #175
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 173 - 221
Target Start/End: Complemental strand, 12322970 - 12322922
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggtttta |
221 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||| |||| |||||||||| |
|
|
| T |
12322970 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
12322922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #176
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 173 - 229
Target Start/End: Original strand, 16083047 - 16083103
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgt |
229 |
Q |
| |
|
||||| ||||||||||||||||| ||||||||| |||| ||| ||||||||| |||| |
|
|
| T |
16083047 |
ggctaaaatatggttttagtccccgcaaatatgtctcgtttttgttttagtctttgt |
16083103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #177
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 292 - 344
Target Start/End: Original strand, 18079516 - 18079568
Alignment:
| Q |
292 |
ccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||||||||||||||| ||||| ||||| || |||||||| ||||| |
|
|
| T |
18079516 |
ccccacttttgtgatgatttgcacacgtggcacatgatgactgaacccatttt |
18079568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #178
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 291 - 343
Target Start/End: Original strand, 18927893 - 18927945
Alignment:
| Q |
291 |
accccacttttgtgatgatttgcatacgtgacacattataactgaaccaattt |
343 |
Q |
| |
|
||||||||||||||||||||| || ||||| ||||| || ||||||||||||| |
|
|
| T |
18927893 |
accccacttttgtgatgatttacacacgtggcacatgatgactgaaccaattt |
18927945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #179
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 291 - 343
Target Start/End: Complemental strand, 19198833 - 19198781
Alignment:
| Q |
291 |
accccacttttgtgatgatttgcatacgtgacacattataactgaaccaattt |
343 |
Q |
| |
|
|||||||||||||||||||||||| ||||| ||||| ||||| ||||| |||| |
|
|
| T |
19198833 |
accccacttttgtgatgatttgcacacgtggcacatgataacggaacccattt |
19198781 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #180
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 21383104 - 21383156
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||| ||||||||||||| |||||| |||| |||||||||||||| |
|
|
| T |
21383104 |
ggctaaaatatgattttagtccctgctaatatgtctcgttttggttttagtcc |
21383156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #181
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 31060787 - 31060839
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||| || | |||||||||||||| |
|
|
| T |
31060787 |
ggctaaaatatggttttggtccctgcaaatatgtcttgttttggttttagtcc |
31060839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #182
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 33045355 - 33045407
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||| ||||||| |||||||||||||||||| | |||||||||||||| |
|
|
| T |
33045355 |
ggctaaaatttggttttggtccctgcaaatatgcctagttttggttttagtcc |
33045407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #183
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 33234912 - 33234860
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||| |||| |||||||||||||||||||| |||| ||||||||| |
|
|
| T |
33234912 |
ggctaaaatatgattttggtccctgcaaatatgcctcgttttgattttagtcc |
33234860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #184
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 39025381 - 39025330
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| ||||||||||| |||||||| |||||||||||||| |
|
|
| T |
39025381 |
ggctaaaatatggttttggtccctgcaaa-atgcctcgttttggttttagtcc |
39025330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #185
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 41738796 - 41738848
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||||||| ||| |||||||||| |
|
|
| T |
41738796 |
ggctaaaatatggttttggtccctgcaaatatgcctcattttagttttagtcc |
41738848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #186
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 291 - 339
Target Start/End: Complemental strand, 42483215 - 42483167
Alignment:
| Q |
291 |
accccacttttgtgatgatttgcatacgtgacacattataactgaacca |
339 |
Q |
| |
|
|||||||||||||||||||||||| ||||| ||||| || ||||||||| |
|
|
| T |
42483215 |
accccacttttgtgatgatttgcacacgtgtcacatgatgactgaacca |
42483167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #187
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 173 - 221
Target Start/End: Complemental strand, 45638894 - 45638846
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggtttta |
221 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||| |||| |||||||||| |
|
|
| T |
45638894 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
45638846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #188
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 292 - 336
Target Start/End: Complemental strand, 51986459 - 51986415
Alignment:
| Q |
292 |
ccccacttttgtgatgatttgcatacgtgacacattataactgaa |
336 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| || |||||| |
|
|
| T |
51986459 |
ccccacttttgtgatgatttgcacacgtgacacatgatgactgaa |
51986415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #189
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 277 - 320
Target Start/End: Original strand, 292959 - 293002
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtg |
320 |
Q |
| |
|
||||||||||| | ||||||||||||||||||||||||||||| |
|
|
| T |
292959 |
gaaaatagtccatagccccacttttgtgatgatttgcatacgtg |
293002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #190
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 173 - 224
Target Start/End: Original strand, 15211511 - 15211562
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtc |
224 |
Q |
| |
|
||||| ||||||||||| ||||||| ||||||| |||| ||||||||||||| |
|
|
| T |
15211511 |
ggctaaaatatggttttggtccctgtaaatatgtctcgttttggttttagtc |
15211562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #191
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 173 - 224
Target Start/End: Original strand, 16060596 - 16060646
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtc |
224 |
Q |
| |
|
||||| ||||||||||| |||||| ||||||||||||| ||||||||||||| |
|
|
| T |
16060596 |
ggctaaaatatggttttggtccct-caaatatgcctcgttttggttttagtc |
16060646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #192
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 179 - 226
Target Start/End: Complemental strand, 17130077 - 17130030
Alignment:
| Q |
179 |
aatatggttttagtccctgcaaatatgcctcggtttggttttagtcct |
226 |
Q |
| |
|
||||||||||| ||||||||||||||| |||| |||||||||| |||| |
|
|
| T |
17130077 |
aatatggttttggtccctgcaaatatgtctcgttttggttttaatcct |
17130030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #193
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 284 - 343
Target Start/End: Original strand, 24510051 - 24510110
Alignment:
| Q |
284 |
gtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattt |
343 |
Q |
| |
|
|||||| |||||||||||||||||||||||| | ||| ||||| || |||||||| |||| |
|
|
| T |
24510051 |
gtccctgaccccacttttgtgatgatttgcagatgtggcacatgatgactgaacctattt |
24510110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #194
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 278 - 325
Target Start/End: Original strand, 29072600 - 29072647
Alignment:
| Q |
278 |
aaaatagtccctcaccccacttttgtgatgatttgcatacgtgacaca |
325 |
Q |
| |
|
|||||||||||| |||||| ||||||||||||| ||||||||| |||| |
|
|
| T |
29072600 |
aaaatagtccctgaccccatttttgtgatgattcgcatacgtggcaca |
29072647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #195
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 292 - 343
Target Start/End: Complemental strand, 32035678 - 32035627
Alignment:
| Q |
292 |
ccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattt |
343 |
Q |
| |
|
||||||||||||||||||||| | ||||||||||| || |||||||| |||| |
|
|
| T |
32035678 |
ccccacttttgtgatgatttgtacacgtgacacatgatgactgaacccattt |
32035627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #196
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 174 - 225
Target Start/End: Original strand, 32420099 - 32420150
Alignment:
| Q |
174 |
gctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
|||| ||||||||||| |||| |||||||||| |||| |||||||||||||| |
|
|
| T |
32420099 |
gctaaaatatggttttggtccttgcaaatatgtctcgttttggttttagtcc |
32420150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #197
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 173 - 224
Target Start/End: Original strand, 42482979 - 42483030
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtc |
224 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||| ||| ||||||||||||| |
|
|
| T |
42482979 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtc |
42483030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #198
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 278 - 325
Target Start/End: Complemental strand, 45368749 - 45368702
Alignment:
| Q |
278 |
aaaatagtccctcaccccacttttgtgatgatttgcatacgtgacaca |
325 |
Q |
| |
|
|||||||||||| |||||| ||||||||||||||||||| ||| |||| |
|
|
| T |
45368749 |
aaaatagtccctgaccccatttttgtgatgatttgcatatgtgtcaca |
45368702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #199
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 179 - 225
Target Start/End: Complemental strand, 5058986 - 5058940
Alignment:
| Q |
179 |
aatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||||||||| ||||||| |||||||||||| |||| ||||||||| |
|
|
| T |
5058986 |
aatatggttttggtccctggaaatatgcctcgttttgattttagtcc |
5058940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #200
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 173 - 219
Target Start/End: Complemental strand, 15211858 - 15211812
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttt |
219 |
Q |
| |
|
||||| ||||||||||| |||| ||||||||||||||| |||||||| |
|
|
| T |
15211858 |
ggctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
15211812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #201
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 179 - 225
Target Start/End: Original strand, 17129695 - 17129741
Alignment:
| Q |
179 |
aatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||||||||| | ||||||||||||||||| |||||||||||||| |
|
|
| T |
17129695 |
aatatggttttgattcctgcaaatatgcctcgttttggttttagtcc |
17129741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #202
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 179 - 225
Target Start/End: Original strand, 26207284 - 26207330
Alignment:
| Q |
179 |
aatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||||||||| |||| |||||||||| |||| |||||||||||||| |
|
|
| T |
26207284 |
aatatggttttggtccttgcaaatatgtctcgttttggttttagtcc |
26207330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #203
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 173 - 226
Target Start/End: Complemental strand, 33380257 - 33380203
Alignment:
| Q |
173 |
ggctagaatatggttttagtccc-tgcaaatatgcctcggtttggttttagtcct |
226 |
Q |
| |
|
||||| ||||||||||||| ||| | ||||||||||||| ||||||||||||||| |
|
|
| T |
33380257 |
ggctaaaatatggttttagccccctacaaatatgcctcgttttggttttagtcct |
33380203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #204
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 41739120 - 41739071
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||||||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
41739120 |
ggctaaaatatggttttagtccctgcaaatat---tcgttttggttttagtcc |
41739071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #205
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 284 - 326
Target Start/End: Complemental strand, 49073944 - 49073902
Alignment:
| Q |
284 |
gtccctcaccccacttttgtgatgatttgcatacgtgacacat |
326 |
Q |
| |
|
|||||| |||||||||||||||||||||||| ||||| ||||| |
|
|
| T |
49073944 |
gtccctgaccccacttttgtgatgatttgcacacgtgtcacat |
49073902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #206
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 173 - 210
Target Start/End: Complemental strand, 4360626 - 4360589
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcg |
210 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |||| |
|
|
| T |
4360626 |
ggctaaaatatggttttagtccctgcaaatatgtctcg |
4360589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #207
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 294 - 343
Target Start/End: Original strand, 10887352 - 10887401
Alignment:
| Q |
294 |
ccacttttgtgatgatttgcatacgtgacacattataactgaaccaattt |
343 |
Q |
| |
|
||||||||||||||||||||| ||||| ||||| || |||||||| |||| |
|
|
| T |
10887352 |
ccacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt |
10887401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #208
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 173 - 222
Target Start/End: Original strand, 12360603 - 12360652
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttag |
222 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||||||| ||| ||||||| |
|
|
| T |
12360603 |
ggctaaaatatggttttggtccctgcaaatatgcctcattttagttttag |
12360652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #209
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 294 - 343
Target Start/End: Original strand, 16060714 - 16060763
Alignment:
| Q |
294 |
ccacttttgtgatgatttgcatacgtgacacattataactgaaccaattt |
343 |
Q |
| |
|
||||||||||||||||||||| ||||| ||||| || |||||||| |||| |
|
|
| T |
16060714 |
ccacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt |
16060763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #210
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 294 - 343
Target Start/End: Original strand, 24977898 - 24977947
Alignment:
| Q |
294 |
ccacttttgtgatgatttgcatacgtgacacattataactgaaccaattt |
343 |
Q |
| |
|
||||||||||||||||||||| ||||| ||||| || |||||||| |||| |
|
|
| T |
24977898 |
ccacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt |
24977947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #211
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 7867357 - 7867305
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||| || |||||||||||||| |
|
|
| T |
7867357 |
ggctaaaatatggttttggtccctgcaaatatgtcttattttggttttagtcc |
7867305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #212
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 173 - 229
Target Start/End: Original strand, 12322604 - 12322660
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgt |
229 |
Q |
| |
|
||||| ||||||||||| |||||||||||||| ||| |||| ||||||||||||| |
|
|
| T |
12322604 |
ggctaaaatatggttttgatccctgcaaatatgtttcgttttgattttagtccttgt |
12322660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #213
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 291 - 343
Target Start/End: Original strand, 12322721 - 12322773
Alignment:
| Q |
291 |
accccacttttgtgatgatttgcatacgtgacacattataactgaaccaattt |
343 |
Q |
| |
|
||||||||||| |||||||||||| | ||| ||||| |||| ||||||||||| |
|
|
| T |
12322721 |
accccacttttatgatgatttgcacatgtggcacatgataattgaaccaattt |
12322773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #214
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 16026573 - 16026625
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||| |||| |||||||||||||| ||||| |||||||||||||| |
|
|
| T |
16026573 |
ggctaaaatataattttggtccctgcaaatatccctcgttttggttttagtcc |
16026625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #215
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 18079398 - 18079450
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||| |||||| |||| |||||||||||||| |||||||||||||| |
|
|
| T |
18079398 |
ggctaaaatacggttttggtccttgcaaatatgcctcattttggttttagtcc |
18079450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #216
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 20948755 - 20948807
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| |||||| |||||||| |||| || ||||||||||| |
|
|
| T |
20948755 |
ggctaaaatatggttttggtccctacaaatatgtctcgtttgggttttagtcc |
20948807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #217
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 173 - 229
Target Start/End: Original strand, 22674203 - 22674259
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgt |
229 |
Q |
| |
|
||||| |||||||||| |||| |||||||||| |||| ||||||||||||| |||| |
|
|
| T |
22674203 |
ggctaaaatatggtttaggtccatgcaaatatgtctcgttttggttttagtctttgt |
22674259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #218
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 173 - 221
Target Start/End: Original strand, 25658014 - 25658062
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggtttta |
221 |
Q |
| |
|
||||| ||||||||||| ||||| ||||||||| |||| |||||||||| |
|
|
| T |
25658014 |
ggctaaaatatggttttggtccccgcaaatatgtctcgttttggtttta |
25658062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #219
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 179 - 223
Target Start/End: Complemental strand, 26062252 - 26062208
Alignment:
| Q |
179 |
aatatggttttagtccctgcaaatatgcctcggtttggttttagt |
223 |
Q |
| |
|
||||||||||||||||||| ||||||| ||| |||||||||||| |
|
|
| T |
26062252 |
aatatggttttagtccctgtaaatatgtctcattttggttttagt |
26062208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #220
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 278 - 326
Target Start/End: Original strand, 27521676 - 27521724
Alignment:
| Q |
278 |
aaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacat |
326 |
Q |
| |
|
|||||||||||| | | || ||||||||||||||||||||||| ||||| |
|
|
| T |
27521676 |
aaaatagtccctgatctcatttttgtgatgatttgcatacgtggcacat |
27521724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #221
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 31061151 - 31061099
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| ||||||||||||| |||| |||||||||||||| |
|
|
| T |
31061151 |
ggctaaaatatggttttgatccctgcaaatatatctcgttttggttttagtcc |
31061099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #222
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 291 - 343
Target Start/End: Original strand, 34002691 - 34002743
Alignment:
| Q |
291 |
accccacttttgtgatgatttgcatacgtgacacattataactgaaccaattt |
343 |
Q |
| |
|
||||||||||||||| |||||||| ||||| ||||| || ||||| ||||||| |
|
|
| T |
34002691 |
accccacttttgtgacgatttgcacacgtggcacatgatgactgagccaattt |
34002743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #223
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 40718474 - 40718422
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||| | | |||| ||||||||| |
|
|
| T |
40718474 |
ggctaaaatatggttttggtccctgcaaatatgcatagttttgattttagtcc |
40718422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #224
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 173 - 221
Target Start/End: Original strand, 49073691 - 49073739
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggtttta |
221 |
Q |
| |
|
||||| ||||||||||| |||| |||||||||| |||| |||||||||| |
|
|
| T |
49073691 |
ggctaaaatatggttttggtccttgcaaatatgtctcgttttggtttta |
49073739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #225
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 173 - 221
Target Start/End: Original strand, 50428873 - 50428921
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggtttta |
221 |
Q |
| |
|
||||| |||||||||||||||| |||||||||| |||| |||| ||||| |
|
|
| T |
50428873 |
ggctaaaatatggttttagtccttgcaaatatgtctcgttttgctttta |
50428921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 68; Significance: 4e-30; HSPs: 212)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 68; E-Value: 4e-30
Query Start/End: Original strand, 277 - 348
Target Start/End: Complemental strand, 22917826 - 22917755
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttatag |
348 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22917826 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttatag |
22917755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 173 - 344
Target Start/End: Original strand, 4375692 - 4375858
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgtnnnnnnnnnnnnnnttgtttttggtccctgcaaaannnnnnnn |
272 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |||||||||| ||| ||| ||||||||||||||||||||| |
|
|
| T |
4375692 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttattccctgtaaaaaaaaa-----ttgtttttggtccctgcaaaattttttgt |
4375786 |
T |
 |
| Q |
273 |
nnnngaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
4375787 |
ttttgaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaatttt |
4375858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 64; E-Value: 9e-28
Query Start/End: Original strand, 277 - 348
Target Start/End: Original strand, 8094581 - 8094652
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttatag |
348 |
Q |
| |
|
||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8094581 |
gaaaatagtccctgaccccatttttgtgatgatttgcatacgtgacacattataactgaaccaattttatag |
8094652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 64; E-Value: 9e-28
Query Start/End: Original strand, 277 - 344
Target Start/End: Complemental strand, 28398938 - 28398871
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28398938 |
gaaaatagtccctaaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
28398871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 174 - 342
Target Start/End: Original strand, 6146517 - 6146681
Alignment:
| Q |
174 |
gctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgtnnnnnnnnnnnnnnttgtttttggtccctgcaaaannnnnnnnn |
273 |
Q |
| |
|
|||| |||||||||||||||| ||||||||||||||| |||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
6146517 |
gctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccttgtaaaaaaaaaa----ttgtttttggtccctgcaaaattttttgtt |
6146612 |
T |
 |
| Q |
274 |
nnngaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatt |
342 |
Q |
| |
|
||||||||| ||| |||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
6146613 |
tttgaaaatagttcctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaatt |
6146681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 277 - 344
Target Start/End: Original strand, 1163013 - 1163080
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
|||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1163013 |
gaaaatagtctctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
1163080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 174 - 344
Target Start/End: Complemental strand, 6146948 - 6146780
Alignment:
| Q |
174 |
gctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgtnnnnnnnnnnnnnnttgtttttggtccctgcaaaannnnnnnnn |
273 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| ||| |||||||||||||| ||| |||||||||||||||||||| |
|
|
| T |
6146948 |
gctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagtccctgt--aaaataaaaattttgtttttggtccctgcaaatttttttgtt |
6146851 |
T |
 |
| Q |
274 |
nnngaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
6146850 |
tttgaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaatttt |
6146780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 277 - 344
Target Start/End: Original strand, 19494220 - 19494287
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
19494220 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaatttt |
19494287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 277 - 344
Target Start/End: Original strand, 25131210 - 25131277
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25131210 |
gaaaatagtccctgaccccacttttatgatgatttgcatacgtgacacattataactgaaccaatttt |
25131277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 277 - 344
Target Start/End: Original strand, 38930403 - 38930470
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
38930403 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaatttt |
38930470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 59; E-Value: 9e-25
Query Start/End: Original strand, 173 - 344
Target Start/End: Original strand, 1525809 - 1525978
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgtnnnnnnnnnnnnnnttgtttttggtccctgcaaaannnnnnnn |
272 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| ||||||||||||| | | ||||||||||||||||||||| |
|
|
| T |
1525809 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc--tctggcaaaaaaaaaatttgtttttggtccctgcaaaattttttgt |
1525906 |
T |
 |
| Q |
273 |
nnnngaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||| ||| ||||||||||||||||||||||| |
|
|
| T |
1525907 |
ttttgaaaatagtccctgaccccacttttgtgatgatttgcataagtggcacattataactgaaccaatttt |
1525978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 59; E-Value: 9e-25
Query Start/End: Original strand, 278 - 344
Target Start/End: Original strand, 4017005 - 4017071
Alignment:
| Q |
278 |
aaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
4017005 |
aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaatttt |
4017071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 59; E-Value: 9e-25
Query Start/End: Original strand, 278 - 344
Target Start/End: Complemental strand, 21125919 - 21125853
Alignment:
| Q |
278 |
aaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21125919 |
aaaatagtctctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
21125853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 59; E-Value: 9e-25
Query Start/End: Original strand, 277 - 347
Target Start/End: Original strand, 40066595 - 40066665
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttata |
347 |
Q |
| |
|
|||||||||| || ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40066595 |
gaaaatagtctctgaccccacttttatgatgatttgcatacgtgacacattataactgaaccaattttata |
40066665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 173 - 344
Target Start/End: Complemental strand, 16644044 - 16643875
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgtnnnnnnnnnnnnnnttgtttttggtccctgcaaaannnnnnnn |
272 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |||| |||||||||||||| || ||||||||||||||||||||| |
|
|
| T |
16644044 |
ggctaaaatatggttttagtccctgcaaatatgactcgttttggttttagtccctg--gtaaaacaaaattttgtttttggtccctgcaaaattttttgt |
16643947 |
T |
 |
| Q |
273 |
nnnngaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||||| |||||| ||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
16643946 |
ttttgaaaatagtcccttaccccaattttgtgatgatttgcatacgtggcacattataactgaaccaatttt |
16643875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 277 - 348
Target Start/End: Complemental strand, 1408253 - 1408182
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttatag |
348 |
Q |
| |
|
|||||||||| || |||||||||||||||||||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
1408253 |
gaaaatagtcactgaccccacttttgtgatgatttgcatacgtggcatattataactgaaccaattttatag |
1408182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 173 - 344
Target Start/End: Complemental strand, 16789369 - 16789205
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgtnnnnnnnnnnnnnnttgtttttggtccctgcaaaannnnnnnn |
272 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |||||||||||||| ||| |||||||||||||| |||||| |
|
|
| T |
16789369 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt----aaaaaaaaatttgtttttggtcccagcaaaa---ttttg |
16789277 |
T |
 |
| Q |
273 |
nnnngaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
16789276 |
ttttgaatatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactaaaccaatttt |
16789205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 277 - 344
Target Start/End: Original strand, 21509796 - 21509863
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||| |||| |
|
|
| T |
21509796 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccagtttt |
21509863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #19
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 277 - 344
Target Start/End: Original strand, 33636424 - 33636491
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
33636424 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataacagaaccaatttt |
33636491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #20
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 277 - 340
Target Start/End: Original strand, 40493054 - 40493117
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
340 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
40493054 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa |
40493117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #21
Raw Score: 54; E-Value: 8e-22
Query Start/End: Original strand, 173 - 344
Target Start/End: Original strand, 22650464 - 22650635
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgtnnnnnnnnnnnnnnttgtttttggtccctgcaaaannnnnnnn |
272 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |||| |||| ||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
22650464 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctgtaaaaaaaaataatattgtttttggtccctgcaaaattttttgt |
22650563 |
T |
 |
| Q |
273 |
nnnngaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||| ||||||||||| ||| ||||||| |
|
|
| T |
22650564 |
ttttgaaaatagtccctggccccacttttgtgatgatttgcatacgtggcacattataaccgaatcaatttt |
22650635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #22
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 277 - 344
Target Start/End: Original strand, 7272522 - 7272589
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
7272522 |
gaaaatagtccctagccccacttttgtgatgatttgcatacgtgttacattataactgaaccaatttt |
7272589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #23
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 277 - 344
Target Start/End: Complemental strand, 14495299 - 14495232
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||| ||| | ||||||||||||||||| |
|
|
| T |
14495299 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacctaataactgaaccaatttt |
14495232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #24
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 277 - 344
Target Start/End: Original strand, 24187668 - 24187735
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
|||||||||| || ||||||||||||||||||||||||||| || ||||||||||||||||||||||| |
|
|
| T |
24187668 |
gaaaatagtctctgaccccacttttgtgatgatttgcatacttggcacattataactgaaccaatttt |
24187735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #25
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 277 - 344
Target Start/End: Complemental strand, 24954910 - 24954843
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||| ||||||||||||||| |||||||||| |
|
|
| T |
24954910 |
gaaaatagtccctgaccccacttttgtgatgatttgcataagtgacacattataacaaaaccaatttt |
24954843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #26
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 179 - 335
Target Start/End: Original strand, 1685120 - 1685274
Alignment:
| Q |
179 |
aatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgtnnnnnnnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnnnnga |
278 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||| |||||||| || |
|
|
| T |
1685120 |
aatatggttttagtccctgcaaatatgcctcgttttggttttagtccttg--gtaaaaaaaaaatttgtttttggtcactgcaaaattttttgcttttga |
1685217 |
T |
 |
| Q |
279 |
aaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactga |
335 |
Q |
| |
|
|||||| |||| |||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
1685218 |
aaataggccctaaccccacttttgtgatgatttgcatacgtggcacattataactga |
1685274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #27
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 173 - 344
Target Start/End: Complemental strand, 10776499 - 10776330
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgtnnnnnnnnnnnnnnttgtttttggtccctgcaaaannnnnnnn |
272 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |||||||||||| | ||| |||||||| |||||||||||| |
|
|
| T |
10776499 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctgtaaaaaaaaaaaa--ttgttttttgtccctgcaaaattttttgt |
10776402 |
T |
 |
| Q |
273 |
nnnngaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||| | ||||||||||||||||||||| |||||||| |||||||| |||||||||||||| |
|
|
| T |
10776401 |
ttttgaaaatagtccttgaccccacttttgtgatgattttcatacgtggcacattatgactgaaccaatttt |
10776330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #28
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 173 - 229
Target Start/End: Original strand, 32418318 - 32418374
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgt |
229 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
32418318 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccttgt |
32418374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #29
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 173 - 348
Target Start/End: Original strand, 33526052 - 33526225
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgtnnnnnnnnnnnnnnttgtttttggtccctgcaaaannnnnnnn |
272 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| ||| |||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
33526052 |
ggctaaaatatggttttagtccctgcaaatatgcttcgctttggttttagtccatgtgaatttttttgt--ttgtttttggtccctgcaaaattttttgt |
33526149 |
T |
 |
| Q |
273 |
nnnngaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttatag |
348 |
Q |
| |
|
|||||||||||| |||||| ||||||||||||||||||||||| ||||| || |||||||| ||||||||| |
|
|
| T |
33526150 |
tttttaaaatagtccctgaccccatttttgtgatgatttgcatacgtggcacatgatgactgaacccattttatag |
33526225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #30
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 277 - 344
Target Start/End: Complemental strand, 32040272 - 32040205
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
|||||||||| || |||||||||||||||||||||||||||||| ||| |||||| |||||||||||| |
|
|
| T |
32040272 |
gaaaatagtctctgaccccacttttgtgatgatttgcatacgtggcacgttataattgaaccaatttt |
32040205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #31
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 14239080 - 14239028
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
14239080 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
14239028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #32
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 19494413 - 19494361
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
19494413 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
19494361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #33
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 22917564 - 22917616
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
22917564 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
22917616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #34
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 27341591 - 27341539
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
27341591 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
27341539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #35
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 173 - 344
Target Start/End: Original strand, 29158354 - 29158523
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgtnnnnnnnnnnnnnnttgtttttggtccctgcaaaannnnnnnn |
272 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |||| |||||||||||||| ||| ||||||||| ||||||||||| |
|
|
| T |
29158354 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaataaaat--ttgtttttgatccctgcaaaattttttgt |
29158451 |
T |
 |
| Q |
273 |
nnnngaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
|||||||||| || |||||||||||||||| |||| |||||||||||| |||||||||||||||||| |
|
|
| T |
29158452 |
ttttgaaaatagtctcttaccccacttttgtgataatttatatacgtgacacaatataactgaaccaatttt |
29158523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #36
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 43477163 - 43477215
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
43477163 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
43477215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #37
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 284 - 343
Target Start/End: Complemental strand, 35115590 - 35115531
Alignment:
| Q |
284 |
gtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattt |
343 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||| || |||||||| |||| |
|
|
| T |
35115590 |
gtccctgaccccacttttgtgatgatttgcatacgtgacacatgatgactgaacccattt |
35115531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #38
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 173 - 223
Target Start/End: Original strand, 14495069 - 14495119
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagt |
223 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
14495069 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
14495119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #39
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 278 - 344
Target Start/End: Original strand, 15719758 - 15719824
Alignment:
| Q |
278 |
aaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
|||||||||||| |||||| ||||||||||||||||||||||| ||||| || |||||||| ||||| |
|
|
| T |
15719758 |
aaaatagtccctgaccccatttttgtgatgatttgcatacgtggcacatgatgactgaacctatttt |
15719824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #40
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 1526172 - 1526120
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |||| |||||||||||||| |
|
|
| T |
1526172 |
ggctaaaatatggttttagtccctgcaaatatggctcgttttggttttagtcc |
1526120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #41
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 2728597 - 2728545
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
2728597 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
2728545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #42
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 4017300 - 4017248
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
4017300 |
ggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtcc |
4017248 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #43
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 4710220 - 4710168
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
4710220 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
4710168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #44
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 7272751 - 7272699
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||||| |||||||||||||||||| |||||||||||||| |
|
|
| T |
7272751 |
ggctaaaatatggttttagcccctgcaaatatgcctcgttttggttttagtcc |
7272699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #45
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 7326421 - 7326369
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
7326421 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
7326369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #46
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 8094841 - 8094789
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
8094841 |
ggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtcc |
8094789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #47
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 11019857 - 11019805
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
11019857 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
11019805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #48
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 11976373 - 11976425
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
11976373 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
11976425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #49
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 14238751 - 14238803
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |||| |||||||||||||| |
|
|
| T |
14238751 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
14238803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #50
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 16643661 - 16643713
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||| | |||||||||||||| |
|
|
| T |
16643661 |
ggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtcc |
16643713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #51
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 229
Target Start/End: Complemental strand, 20278057 - 20278001
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgt |
229 |
Q |
| |
|
||||| ||||||||||| ||||||||| |||||||||| |||||||||||||||||| |
|
|
| T |
20278057 |
ggctaaaatatggttttggtccctgcagatatgcctcgttttggttttagtccttgt |
20278001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #52
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 229
Target Start/End: Complemental strand, 21064684 - 21064628
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgt |
229 |
Q |
| |
|
||||| ||||||||||| ||||||||| |||||||||| |||||||||||||||||| |
|
|
| T |
21064684 |
ggctaaaatatggttttggtccctgcagatatgcctcgttttggttttagtccttgt |
21064628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #53
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 24955010 - 24954958
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |||| |||||||||||||| |
|
|
| T |
24955010 |
ggctaaaatatggttttagtccctgcaaatatgactcgttttggttttagtcc |
24954958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #54
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 25131447 - 25131395
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||||||||||| ||||||||||||||||| |||||||||||||| |
|
|
| T |
25131447 |
ggctaaaatatggttttagttcctgcaaatatgcctcgttttggttttagtcc |
25131395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #55
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 28346394 - 28346446
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
28346394 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
28346446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #56
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 28346758 - 28346706
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
28346758 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
28346706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #57
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 29488110 - 29488058
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
29488110 |
ggctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagtcc |
29488058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #58
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 32726271 - 32726219
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
32726271 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
32726219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #59
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 33526412 - 33526360
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||| ||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
33526412 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtcc |
33526360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #60
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 33636322 - 33636374
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
33636322 |
ggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtcc |
33636374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #61
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 34963300 - 34963352
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
34963300 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
34963352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #62
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 35097692 - 35097640
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
35097692 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
35097640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #63
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 37536086 - 37536138
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
37536086 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
37536138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #64
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 40066820 - 40066768
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||| || |||||||||||||| |
|
|
| T |
40066820 |
ggctaaaatatggttttagtccctgcaaatatgccccgttttggttttagtcc |
40066768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #65
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 40844156 - 40844208
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
40844156 |
ggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtcc |
40844208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #66
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 174 - 221
Target Start/End: Original strand, 4016906 - 4016953
Alignment:
| Q |
174 |
gctagaatatggttttagtccctgcaaatatgcctcggtttggtttta |
221 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
4016906 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
4016953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #67
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 173 - 224
Target Start/End: Original strand, 7272420 - 7272471
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtc |
224 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |||| ||||||||||||| |
|
|
| T |
7272420 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
7272471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #68
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 277 - 344
Target Start/End: Original strand, 14488816 - 14488883
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||||| |||||| ||||||||||||||||||| ||| ||||| || |||||||| ||||| |
|
|
| T |
14488816 |
gaaaatagtccctgaccccatttttgtgatgatttgcatatgtggcacatgatgactgaacccatttt |
14488883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #69
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 173 - 224
Target Start/End: Original strand, 18549201 - 18549252
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtc |
224 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| ||| ||||||||||||| |
|
|
| T |
18549201 |
ggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtc |
18549252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #70
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 277 - 344
Target Start/End: Complemental strand, 27341489 - 27341422
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
|||||||||| || |||||||||||| | || ||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
27341489 |
gaaaatagtctctgaccccacttttgcggtggtttgcttacgtggcacattataactgaaccaatttt |
27341422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #71
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 179 - 229
Target Start/End: Original strand, 10776154 - 10776204
Alignment:
| Q |
179 |
aatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgt |
229 |
Q |
| |
|
||||||||||||||||||||||||||| |||| |||||||||| ||||||| |
|
|
| T |
10776154 |
aatatggttttagtccctgcaaatatgtctcgttttggttttaatccttgt |
10776204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #72
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 278 - 344
Target Start/End: Original strand, 14238852 - 14238918
Alignment:
| Q |
278 |
aaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
|||||||||||| |||||| ||||||||||||||||||||||| ||| | || |||||||| ||||| |
|
|
| T |
14238852 |
aaaatagtccctgaccccatttttgtgatgatttgcatacgtggcacctgatgactgaacccatttt |
14238918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #73
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 173 - 223
Target Start/End: Original strand, 16789075 - 16789125
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagt |
223 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |||| |||||||||||| |
|
|
| T |
16789075 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt |
16789125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #74
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 173 - 223
Target Start/End: Original strand, 19494119 - 19494169
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagt |
223 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |||| |||||||||||| |
|
|
| T |
19494119 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt |
19494169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #75
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 278 - 344
Target Start/End: Original strand, 19963099 - 19963165
Alignment:
| Q |
278 |
aaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
|||||||||||| |||||| ||||||||||||||||||||||| | || ||||||||||| ||||| |
|
|
| T |
19963099 |
aaaatagtccctgaccccatttttgtgatgatttgcatacgtggtatatgataactgaaccgatttt |
19963165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #76
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 174 - 224
Target Start/End: Complemental strand, 24090487 - 24090437
Alignment:
| Q |
174 |
gctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtc |
224 |
Q |
| |
|
|||| ||||||||||| |||||||||||||||||||| ||||||||||||| |
|
|
| T |
24090487 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc |
24090437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #77
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 173 - 223
Target Start/End: Original strand, 25131111 - 25131161
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagt |
223 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |||| |||||||||||| |
|
|
| T |
25131111 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt |
25131161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #78
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 173 - 223
Target Start/End: Original strand, 40066497 - 40066547
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagt |
223 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| ||| |||||||| |
|
|
| T |
40066497 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttagttttagt |
40066547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #79
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 278 - 344
Target Start/End: Complemental strand, 43477411 - 43477345
Alignment:
| Q |
278 |
aaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
|||||||||||| |||||| ||||||||||||||||||||| | ||||| || |||||||| ||||| |
|
|
| T |
43477411 |
aaaatagtccctgaccccatttttgtgatgatttgcatacgagtcacatgatgactgaaccgatttt |
43477345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #80
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 1162909 - 1162961
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| ||| |||| ||||||||| |
|
|
| T |
1162909 |
ggctaaaatatggttttagtccctgcaaatatgcttcgttttgattttagtcc |
1162961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #81
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 1408353 - 1408301
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||| ||| |||||||||| |
|
|
| T |
1408353 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttagttttagtcc |
1408301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #82
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 1778564 - 1778616
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||| |||| |||||||||||||| |
|
|
| T |
1778564 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
1778616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #83
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 3511906 - 3511958
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| |||||| ||||||||||||| |||||||||||||| |
|
|
| T |
3511906 |
ggctaaaatatggttttggtcccttcaaatatgcctcgttttggttttagtcc |
3511958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #84
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 3512266 - 3512214
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||| |||| |||||||||||||| |
|
|
| T |
3512266 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
3512214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #85
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 4474044 - 4473992
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
4474044 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
4473992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #86
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 4621354 - 4621302
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||| ||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
4621354 |
ggctaaaatatagttttggtccctgcaaatatgcctcgttttggttttagtcc |
4621302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #87
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 5357423 - 5357475
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||| |||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
5357423 |
ggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtcc |
5357475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #88
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 7186004 - 7185952
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||| |||| |||||||||||||| |
|
|
| T |
7186004 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
7185952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #89
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 7326086 - 7326138
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| |||| ||||||||||||||| |||||||||||||| |
|
|
| T |
7326086 |
ggctaaaatatggttttggtccttgcaaatatgcctcgttttggttttagtcc |
7326138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #90
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 7420230 - 7420282
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||| |||| |||||||||||||| |
|
|
| T |
7420230 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
7420282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #91
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 7420590 - 7420538
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| ||| |||||||||||||||| |||||||||||||| |
|
|
| T |
7420590 |
ggctaaaatatggttttggtcactgcaaatatgcctcgttttggttttagtcc |
7420538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #92
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 8094479 - 8094531
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||||||| ||||||||||| |||| |||||||||||||| |
|
|
| T |
8094479 |
ggctaaaatatggttttagtctctgcaaatatgtctcgttttggttttagtcc |
8094531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #93
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 8298587 - 8298639
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||| |||| |||||||||||||| |
|
|
| T |
8298587 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
8298639 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #94
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 8298975 - 8298923
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||| |||| |||||||||||||| |
|
|
| T |
8298975 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
8298923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #95
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 9496723 - 9496671
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||| ||| |||||||||||||| |
|
|
| T |
9496723 |
ggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtcc |
9496671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #96
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 10337119 - 10337171
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||| |||| |||||||||||||| |
|
|
| T |
10337119 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
10337171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #97
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 10337449 - 10337397
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||||||| ||| |||||||||| |
|
|
| T |
10337449 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttagttttagtcc |
10337397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #98
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 10540782 - 10540730
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||| ||| |||||||||||||| |
|
|
| T |
10540782 |
ggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtcc |
10540730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #99
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 221
Target Start/End: Complemental strand, 10755528 - 10755480
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggtttta |
221 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |||| ||||| |
|
|
| T |
10755528 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttgatttta |
10755480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #100
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 10872915 - 10872967
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
10872915 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
10872967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #101
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 10873280 - 10873228
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| ||| |||||||||||||||| |||||||||||||| |
|
|
| T |
10873280 |
ggctaaaatatggttttggtctctgcaaatatgcctcgttttggttttagtcc |
10873228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #102
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 11019520 - 11019572
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||| |||| |||||||||||||| |
|
|
| T |
11019520 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
11019572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #103
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 14489073 - 14489021
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||| |||| |||||||||||||| |
|
|
| T |
14489073 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
14489021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #104
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 174 - 225
Target Start/End: Complemental strand, 14495389 - 14495338
Alignment:
| Q |
174 |
gctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
|||| |||||||| |||||||| |||||||||||||| |||||||||||||| |
|
|
| T |
14495389 |
gctaaaatatggtnttagtccccgcaaatatgcctcgttttggttttagtcc |
14495338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #105
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 14496816 - 14496868
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||||||||||| ||||||||||||| ||| |||||||||||||| |
|
|
| T |
14496816 |
ggctaaaatatggttttagttcctgcaaatatgcgtcgttttggttttagtcc |
14496868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #106
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 15719656 - 15719708
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||||||||||||||||||||||| |||| |||||||||||||| |
|
|
| T |
15719656 |
ggctaaaatatggttttagtccctgcaaatatatctcgttttggttttagtcc |
15719708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #107
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 20277692 - 20277744
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||||||| ||| |||||||||| |
|
|
| T |
20277692 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttagttttagtcc |
20277744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #108
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 20984146 - 20984198
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||| |||| |||||||||||||| |
|
|
| T |
20984146 |
ggctaaaatatggttttggtccctgcaaatatggctcgttttggttttagtcc |
20984198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #109
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 21064319 - 21064371
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||||||| ||| |||||||||| |
|
|
| T |
21064319 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttagttttagtcc |
21064371 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #110
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 221
Target Start/End: Original strand, 21125719 - 21125767
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggtttta |
221 |
Q |
| |
|
||||| ||||| |||||||||||||||||||||||||| |||||||||| |
|
|
| T |
21125719 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggtttta |
21125767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #111
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 24187569 - 24187621
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||||||||| ||||||||||||||| ||| |||||||||||||| |
|
|
| T |
24187569 |
ggctaaaatatggttttaatccctgcaaatatgcttcgttttggttttagtcc |
24187621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #112
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 24187897 - 24187845
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||| |||||||||||||||||||| |||| |||||||||||||| |
|
|
| T |
24187897 |
ggctaaaatatgattttagtccctgcaaatatgtctcgttttggttttagtcc |
24187845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #113
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 179 - 227
Target Start/End: Original strand, 24814711 - 24814759
Alignment:
| Q |
179 |
aatatggttttagtccctgcaaatatgcctcggtttggttttagtcctt |
227 |
Q |
| |
|
||||||||||| ||||||||||||||||||| |||||||||||||||| |
|
|
| T |
24814711 |
aatatggttttggtccctgcaaatatgcctcattttggttttagtcctt |
24814759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #114
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 28323849 - 28323901
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||| |||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
28323849 |
ggctaaaatatggttgtagtccctgcaaatatgcttcgttttggttttagtcc |
28323901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #115
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 229
Target Start/End: Complemental strand, 29158669 - 29158613
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgt |
229 |
Q |
| |
|
||||| |||||||||||| ||||||||||||| |||| |||||||||||||||||| |
|
|
| T |
29158669 |
ggctaaaatatggttttaatccctgcaaatatatctcgttttggttttagtccttgt |
29158613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #116
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 32725907 - 32725959
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||| |||| |||||||||||||| |
|
|
| T |
32725907 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
32725959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #117
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 34963664 - 34963612
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||| |||| |||||||||||||| |
|
|
| T |
34963664 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
34963612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #118
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 35097328 - 35097380
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||| |||| |||||||||||||| |
|
|
| T |
35097328 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
35097380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #119
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 221
Target Start/End: Complemental strand, 35345617 - 35345569
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggtttta |
221 |
Q |
| |
|
||||| |||||||||||||| ||||||||||||||||| |||||||||| |
|
|
| T |
35345617 |
ggctaaaatatggttttagttcctgcaaatatgcctcgttttggtttta |
35345569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #120
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 35346629 - 35346681
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||| |||| |||||||||||||| |
|
|
| T |
35346629 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
35346681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #121
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 35346998 - 35346946
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||| |||| |||||||||||||| |
|
|
| T |
35346998 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
35346946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #122
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 37536419 - 37536367
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||| ||| |||||||||||||| |
|
|
| T |
37536419 |
ggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtcc |
37536367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #123
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 221
Target Start/End: Complemental strand, 38930664 - 38930616
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggtttta |
221 |
Q |
| |
|
||||| |||||| ||||||||||||||||||||||||| |||||||||| |
|
|
| T |
38930664 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
38930616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #124
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 40492960 - 40493012
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||||||||||| |||||||||||| |||| |||||||||||||| |
|
|
| T |
40492960 |
ggctaaaatatggttttagtacctgcaaatatgtctcgttttggttttagtcc |
40493012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #125
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 42133154 - 42133102
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||| |||| |||||||||||||| |
|
|
| T |
42133154 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
42133102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #126
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 229
Target Start/End: Complemental strand, 42430120 - 42430064
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgt |
229 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
42430120 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccttgt |
42430064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #127
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 173 - 224
Target Start/End: Complemental strand, 4376010 - 4375960
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtc |
224 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| || |||||||||||||| |
|
|
| T |
4376010 |
ggctaaaatatggttttagtccctgcaaatatgcttc-gtttggttttagtc |
4375960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #128
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 173 - 224
Target Start/End: Original strand, 14488716 - 14488767
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtc |
224 |
Q |
| |
|
||||| ||||| ||||||||||||| |||||||||||| ||||||||||||| |
|
|
| T |
14488716 |
ggctaaaatatagttttagtccctgaaaatatgcctcgttttggttttagtc |
14488767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #129
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 277 - 344
Target Start/End: Original strand, 18549305 - 18549372
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
|||||||||| || |||||| ||||||||||||||||||||||| ||||| || ||| |||| ||||| |
|
|
| T |
18549305 |
gaaaatagtctctgaccccatttttgtgatgatttgcatacgtggcacatgatgacttaacctatttt |
18549372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #130
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 282 - 337
Target Start/End: Original strand, 23939654 - 23939709
Alignment:
| Q |
282 |
tagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaac |
337 |
Q |
| |
|
|||||||| |||||||||||||||||||||||| | ||||||||| || ||||||| |
|
|
| T |
23939654 |
tagtccctgaccccacttttgtgatgatttgcacatgtgacacatgatgactgaac |
23939709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #131
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 284 - 343
Target Start/End: Original strand, 28497363 - 28497422
Alignment:
| Q |
284 |
gtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattt |
343 |
Q |
| |
|
|||||| |||||||||||||||||||||||| ||||| ||||| || |||||||| |||| |
|
|
| T |
28497363 |
gtccctgaccccacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt |
28497422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #132
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 284 - 343
Target Start/End: Complemental strand, 29992192 - 29992133
Alignment:
| Q |
284 |
gtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattt |
343 |
Q |
| |
|
|||||| ||||||||||||||||||||| || ||||||||||| || |||||||| |||| |
|
|
| T |
29992192 |
gtccctgaccccacttttgtgatgatttacacacgtgacacatgatgactgaacccattt |
29992133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #133
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 277 - 320
Target Start/End: Original strand, 30337023 - 30337066
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtg |
320 |
Q |
| |
|
||||||||||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
30337023 |
gaaaatagtccctgaccccatttttgtgatgatttgcatacgtg |
30337066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #134
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 277 - 344
Target Start/End: Original strand, 32195381 - 32195448
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
|||||||||| || ||||||||||| ||||||| |||||||||||||||| || | |||||| ||||| |
|
|
| T |
32195381 |
gaaaatagtctctgaccccacttttatgatgatatgcatacgtgacacatgatgattgaacctatttt |
32195448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #135
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 173 - 223
Target Start/End: Original strand, 6469280 - 6469330
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagt |
223 |
Q |
| |
|
||||| ||||||| ||| |||||||||||||||||||| |||||||||||| |
|
|
| T |
6469280 |
ggctaaaatatggctttcgtccctgcaaatatgcctcgttttggttttagt |
6469330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #136
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 173 - 223
Target Start/End: Original strand, 9496341 - 9496391
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagt |
223 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||| |||| |||||||||||| |
|
|
| T |
9496341 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
9496391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #137
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 278 - 344
Target Start/End: Complemental strand, 10755429 - 10755363
Alignment:
| Q |
278 |
aaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||| || ||| ||||||||||||||||||||||| ||||| || |||||||| ||||| |
|
|
| T |
10755429 |
aaaatagtccccgactccatttttgtgatgatttgcatacgtggcacatgatgactgaaccgatttt |
10755363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #138
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 179 - 225
Target Start/End: Complemental strand, 11976730 - 11976684
Alignment:
| Q |
179 |
aatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||||||||| ||||||||||||||| |||| |||||||||||||| |
|
|
| T |
11976730 |
aatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
11976684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #139
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 179 - 225
Target Start/End: Original strand, 13232204 - 13232250
Alignment:
| Q |
179 |
aatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||||||||| ||||||||||||||| |||| |||||||||||||| |
|
|
| T |
13232204 |
aatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
13232250 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #140
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 173 - 223
Target Start/End: Complemental strand, 13232562 - 13232512
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagt |
223 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||||||| |||||||||||| |
|
|
| T |
13232562 |
ggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagt |
13232512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #141
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 179 - 225
Target Start/End: Complemental strand, 18549567 - 18549521
Alignment:
| Q |
179 |
aatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||||||||| ||||||||||||||| |||| |||||||||||||| |
|
|
| T |
18549567 |
aatatggttttcgtccctgcaaatatgtctcgttttggttttagtcc |
18549521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #142
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 173 - 223
Target Start/End: Original strand, 25600230 - 25600280
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagt |
223 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||| |||| |||||||||||| |
|
|
| T |
25600230 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
25600280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #143
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 179 - 225
Target Start/End: Complemental strand, 28497613 - 28497567
Alignment:
| Q |
179 |
aatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
|||||| |||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
28497613 |
aatatgattttggtccctgcaaatatgcctcgttttggttttagtcc |
28497567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #144
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 278 - 344
Target Start/End: Complemental strand, 32418577 - 32418511
Alignment:
| Q |
278 |
aaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||| || |||||| ||||||||||||||||||||||| ||||| || ||| |||| ||||| |
|
|
| T |
32418577 |
aaaatagtctctgaccccatttttgtgatgatttgcatacgtggcacatgatgactaaaccgatttt |
32418511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #145
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 278 - 348
Target Start/End: Complemental strand, 35143743 - 35143674
Alignment:
| Q |
278 |
aaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttatag |
348 |
Q |
| |
|
|||||||||| | |||||| ||||||||||||||||||| ||| ||||| ||||| ||||| ||||||||| |
|
|
| T |
35143743 |
aaaatagtccatgacccca-ttttgtgatgatttgcataagtggcacatgataaccgaaccgattttatag |
35143674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #146
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 173 - 223
Target Start/End: Original strand, 38930302 - 38930352
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagt |
223 |
Q |
| |
|
||||| ||||||||||||||||||| ||||||| |||| |||||||||||| |
|
|
| T |
38930302 |
ggctaaaatatggttttagtccctgtaaatatgtctcgttttggttttagt |
38930352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #147
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 179 - 225
Target Start/End: Complemental strand, 40844529 - 40844483
Alignment:
| Q |
179 |
aatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
|||||||||||||||||||||||||| |||| |||||||||||||| |
|
|
| T |
40844529 |
aatatggttttagtccctgcaaatatatctcgttttggttttagtcc |
40844483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #148
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 278 - 344
Target Start/End: Complemental strand, 43727328 - 43727262
Alignment:
| Q |
278 |
aaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
|||||||||| | |||||| ||||||||||||||| ||||||| ||||| || |||||||| ||||| |
|
|
| T |
43727328 |
aaaatagtccttgaccccatttttgtgatgatttggatacgtggcacatgatgactgaacccatttt |
43727262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #149
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 179 - 229
Target Start/End: Complemental strand, 43727427 - 43727378
Alignment:
| Q |
179 |
aatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgt |
229 |
Q |
| |
|
|||||||||||||||| |||||||||| |||| |||||||||||||||||| |
|
|
| T |
43727427 |
aatatggttttagtcc-tgcaaatatgtctcgttttggttttagtccttgt |
43727378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #150
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 291 - 348
Target Start/End: Original strand, 2811557 - 2811614
Alignment:
| Q |
291 |
accccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttatag |
348 |
Q |
| |
|
|||||||||||||||||||||| ||||||| ||||| || ||| |||| ||||||||| |
|
|
| T |
2811557 |
accccacttttgtgatgatttgtatacgtggcacatgatgactaaacccattttatag |
2811614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #151
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 179 - 224
Target Start/End: Complemental strand, 9175365 - 9175320
Alignment:
| Q |
179 |
aatatggttttagtccctgcaaatatgcctcggtttggttttagtc |
224 |
Q |
| |
|
||||||||||| ||||||| |||||||||||| ||||||||||||| |
|
|
| T |
9175365 |
aatatggttttggtccctgtaaatatgcctcgttttggttttagtc |
9175320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #152
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 294 - 343
Target Start/End: Original strand, 13232317 - 13232366
Alignment:
| Q |
294 |
ccacttttgtgatgatttgcatacgtgacacattataactgaaccaattt |
343 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| || |||||||| |||| |
|
|
| T |
13232317 |
ccacttttgtgatgatttgcacacgtgacacatgatgactgaacccattt |
13232366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #153
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 173 - 218
Target Start/End: Complemental strand, 40493157 - 40493112
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggtt |
218 |
Q |
| |
|
||||| ||| |||||||||||||||||||||||||||| ||||||| |
|
|
| T |
40493157 |
ggctaaaatgtggttttagtccctgcaaatatgcctcgttttggtt |
40493112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #154
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 2728232 - 2728284
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||| |||| ||||||||||||||| |||| |||||||||||||| |
|
|
| T |
2728232 |
ggctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagtcc |
2728284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #155
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 4473704 - 4473756
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| ||||||||||||| | |||| |||||||||||||| |
|
|
| T |
4473704 |
ggctaaaatatggttttggtccctgcaaatacgtctcgttttggttttagtcc |
4473756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #156
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 10540449 - 10540501
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||| ||||| ||| |||||||||||||||| |||||||||||||| |
|
|
| T |
10540449 |
ggctaaaatattgttttggtctctgcaaatatgcctcgttttggttttagtcc |
10540501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #157
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 174 - 222
Target Start/End: Complemental strand, 13779531 - 13779483
Alignment:
| Q |
174 |
gctagaatatggttttagtccctgcaaatatgcctcggtttggttttag |
222 |
Q |
| |
|
|||| ||||||| ||| |||||||||||||||||||| ||||||||||| |
|
|
| T |
13779531 |
gctaaaatatggatttggtccctgcaaatatgcctcgttttggttttag |
13779483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #158
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 291 - 343
Target Start/End: Complemental strand, 15931153 - 15931101
Alignment:
| Q |
291 |
accccacttttgtgatgatttgcatacgtgacacattataactgaaccaattt |
343 |
Q |
| |
|
|||||||||||||||||||||||| ||||| ||||| || |||||||| |||| |
|
|
| T |
15931153 |
accccacttttgtgatgatttgcacacgtgtcacatgatgactgaacccattt |
15931101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #159
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 17073807 - 17073859
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||| ||| |||||||||||||| |
|
|
| T |
17073807 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtcc |
17073859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #160
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 17574463 - 17574411
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||| ||| |||||||||||||| |
|
|
| T |
17574463 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtcc |
17574411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #161
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 20984510 - 20984458
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| |||||| |||||||| |||| |||||||||||||| |
|
|
| T |
20984510 |
ggctaaaatatggttttggtccctacaaatatgtctcgttttggttttagtcc |
20984458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #162
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 27117976 - 27117924
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||||||| ||||||||| |||| |
|
|
| T |
27117976 |
ggctaaaatatggttttggtccctgcaaatatgcctcattttggttttggtcc |
27117924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #163
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 173 - 209
Target Start/End: Original strand, 28398756 - 28398792
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctc |
209 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
28398756 |
ggctaaaatatggttttagtccctgcaaatatgcctc |
28398792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #164
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 173 - 229
Target Start/End: Complemental strand, 28399035 - 28398979
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgt |
229 |
Q |
| |
|
||||| |||||| |||||||||||||||||||| ||| |||||||||||||| ||| |
|
|
| T |
28399035 |
ggctaaaatatgattttagtccctgcaaatatggttcgttttggttttagtccctgt |
28398979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #165
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 28497255 - 28497307
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||| |||| |||||||||||||||||||| ||| |||||||||| |
|
|
| T |
28497255 |
ggctaaaatatgattttggtccctgcaaatatgcctcgttttagttttagtcc |
28497307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #166
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 278 - 338
Target Start/End: Complemental strand, 29488009 - 29487949
Alignment:
| Q |
278 |
aaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaacc |
338 |
Q |
| |
|
|||||||||| | |||||| ||||||||||||||||||| ||| ||||| || |||||||| |
|
|
| T |
29488009 |
aaaatagtccttgaccccatttttgtgatgatttgcatatgtggcacatgatgactgaacc |
29487949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #167
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 179 - 223
Target Start/End: Original strand, 33652196 - 33652240
Alignment:
| Q |
179 |
aatatggttttagtccctgcaaatatgcctcggtttggttttagt |
223 |
Q |
| |
|
|||||| ||||||||||||||||||||||||| ||| |||||||| |
|
|
| T |
33652196 |
aatatgattttagtccctgcaaatatgcctcgttttagttttagt |
33652240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #168
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 35115639 - 35115587
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||||||||||||||| ||||||| ||||| ||||||||| |||| |
|
|
| T |
35115639 |
ggctaaaatatggttttagtccctacaaatatacctcgttttggttttggtcc |
35115587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #169
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 35143844 - 35143792
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||||||||| ||| || |||||||||||| |||||||||||||| |
|
|
| T |
35143844 |
ggctaaaatatggttttaatccgtgtaaatatgcctcgttttggttttagtcc |
35143792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #170
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 278 - 326
Target Start/End: Complemental strand, 40844434 - 40844386
Alignment:
| Q |
278 |
aaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacat |
326 |
Q |
| |
|
|||||||||||| | |||| ||||||||||||||||||||||| ||||| |
|
|
| T |
40844434 |
aaaatagtccctgatcccatttttgtgatgatttgcatacgtggcacat |
40844386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #171
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 173 - 221
Target Start/End: Original strand, 42132864 - 42132912
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggtttta |
221 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||| |||| |||||||||| |
|
|
| T |
42132864 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
42132912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #172
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 173 - 224
Target Start/End: Complemental strand, 1163274 - 1163223
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtc |
224 |
Q |
| |
|
||||| |||||||||||||||| |||||||||||| || ||| ||||||||| |
|
|
| T |
1163274 |
ggctaaaatatggttttagtccatgcaaatatgccccgttttagttttagtc |
1163223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #173
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 174 - 229
Target Start/End: Complemental strand, 5357762 - 5357707
Alignment:
| Q |
174 |
gctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgt |
229 |
Q |
| |
|
|||| |||||| |||| |||||||||||||||| ||| ||||||||||||| |||| |
|
|
| T |
5357762 |
gctaaaatatgattttggtccctgcaaatatgcttcgttttggttttagtctttgt |
5357707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #174
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 284 - 343
Target Start/End: Original strand, 8298696 - 8298755
Alignment:
| Q |
284 |
gtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattt |
343 |
Q |
| |
|
|||||| || ||||||||||||||||||||| ||||| ||||| || |||||||| |||| |
|
|
| T |
8298696 |
gtccctgactccacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt |
8298755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #175
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 277 - 344
Target Start/End: Original strand, 14496914 - 14496981
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
|||||| |||||| ||| || ||||||||||||||||||| ||| ||||| || |||||||| ||||| |
|
|
| T |
14496914 |
gaaaatcgtccctgacctcatttttgtgatgatttgcatatgtggcacatgatgactgaacccatttt |
14496981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #176
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 282 - 337
Target Start/End: Complemental strand, 17074061 - 17074006
Alignment:
| Q |
282 |
tagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaac |
337 |
Q |
| |
|
|||||||| || |||||||| |||||||||||| ||||||||||| || ||||||| |
|
|
| T |
17074061 |
tagtccctgactccacttttatgatgatttgcacacgtgacacatgatgactgaac |
17074006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #177
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 282 - 337
Target Start/End: Original strand, 17574209 - 17574264
Alignment:
| Q |
282 |
tagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaac |
337 |
Q |
| |
|
|||||||| || |||||||| |||||||||||| ||||||||||| || ||||||| |
|
|
| T |
17574209 |
tagtccctgactccacttttatgatgatttgcacacgtgacacatgatgactgaac |
17574264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #178
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 179 - 225
Target Start/End: Original strand, 3680533 - 3680579
Alignment:
| Q |
179 |
aatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||||||||| |||||||||||||| |||| |||||||||||||| |
|
|
| T |
3680533 |
aatatggttttgctccctgcaaatatgactcgttttggttttagtcc |
3680579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #179
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 298 - 344
Target Start/End: Complemental strand, 7578409 - 7578363
Alignment:
| Q |
298 |
ttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||||||||||||||| ||||| || |||||||| ||||| |
|
|
| T |
7578409 |
ttttgtgatgatttgcatacgtggcacatgatgactgaacccatttt |
7578363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #180
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 179 - 225
Target Start/End: Complemental strand, 29992294 - 29992248
Alignment:
| Q |
179 |
aatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||||||||| ||||||||||||||||||| |||| ||||||||| |
|
|
| T |
29992294 |
aatatggttttgttccctgcaaatatgcctcgttttgattttagtcc |
29992248 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #181
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 173 - 219
Target Start/End: Complemental strand, 30337217 - 30337171
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttt |
219 |
Q |
| |
|
||||| ||||| ||||||||||||||||||||| |||| |||||||| |
|
|
| T |
30337217 |
ggctaaaatatagttttagtccctgcaaatatgtctcgttttggttt |
30337171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #182
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 173 - 222
Target Start/End: Original strand, 1408005 - 1408054
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttag |
222 |
Q |
| |
|
||||| |||||||||||||||| |||||||||| |||| ||| ||||||| |
|
|
| T |
1408005 |
ggctaaaatatggttttagtccatgcaaatatgtctcgttttagttttag |
1408054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #183
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 179 - 224
Target Start/End: Complemental strand, 2811775 - 2811730
Alignment:
| Q |
179 |
aatatggttttagtccctgcaaatatgcctcggtttggttttagtc |
224 |
Q |
| |
|
||||||||||| |||||||||||||| |||| ||||||||||||| |
|
|
| T |
2811775 |
aatatggttttgatccctgcaaatatgtctcgttttggttttagtc |
2811730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #184
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 294 - 343
Target Start/End: Complemental strand, 4621235 - 4621186
Alignment:
| Q |
294 |
ccacttttgtgatgatttgcatacgtgacacattataactgaaccaattt |
343 |
Q |
| |
|
||||||||||||||||||||| |||| |||||| || |||||||| |||| |
|
|
| T |
4621235 |
ccacttttgtgatgatttgcacacgtcacacatgatgactgaacccattt |
4621186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #185
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 294 - 343
Target Start/End: Original strand, 7326205 - 7326254
Alignment:
| Q |
294 |
ccacttttgtgatgatttgcatacgtgacacattataactgaaccaattt |
343 |
Q |
| |
|
||||||||||||||||||||| ||||| ||||| || |||||||| |||| |
|
|
| T |
7326205 |
ccacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt |
7326254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #186
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 294 - 343
Target Start/End: Original strand, 7420349 - 7420398
Alignment:
| Q |
294 |
ccacttttgtgatgatttgcatacgtgacacattataactgaaccaattt |
343 |
Q |
| |
|
||||||||||||||||||||| ||||| ||||| || |||||||| |||| |
|
|
| T |
7420349 |
ccacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt |
7420398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #187
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 292 - 337
Target Start/End: Original strand, 20277809 - 20277854
Alignment:
| Q |
292 |
ccccacttttgtgatgatttgcatacgtgacacattataactgaac |
337 |
Q |
| |
|
||||||||||||||||||||| | ||||| ||||| |||||||||| |
|
|
| T |
20277809 |
ccccacttttgtgatgatttgaacacgtggcacatgataactgaac |
20277854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #188
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 292 - 337
Target Start/End: Original strand, 21064436 - 21064481
Alignment:
| Q |
292 |
ccccacttttgtgatgatttgcatacgtgacacattataactgaac |
337 |
Q |
| |
|
||||||||||||||||||||| | ||||| ||||| |||||||||| |
|
|
| T |
21064436 |
ccccacttttgtgatgatttgaacacgtggcacatgataactgaac |
21064481 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #189
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 173 - 226
Target Start/End: Complemental strand, 28258241 - 28258188
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcct |
226 |
Q |
| |
|
||||| |||||||||||| | ||||||||||| |||| ||||||||||||||| |
|
|
| T |
28258241 |
ggctaaaatatggttttaacctctgcaaatatgtctcgttttggttttagtcct |
28258188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #190
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 179 - 224
Target Start/End: Original strand, 29991921 - 29991966
Alignment:
| Q |
179 |
aatatggttttagtccctgcaaatatgcctcggtttggttttagtc |
224 |
Q |
| |
|
||||||||||| ||| |||||||||||||||| ||| ||||||||| |
|
|
| T |
29991921 |
aatatggttttggtctctgcaaatatgcctcgttttagttttagtc |
29991966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #191
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 295 - 343
Target Start/End: Original strand, 2356005 - 2356053
Alignment:
| Q |
295 |
cacttttgtgatgatttgcatacgtgacacattataactgaaccaattt |
343 |
Q |
| |
|
|||||||||||||||||||| || |||||||| || |||||||| |||| |
|
|
| T |
2356005 |
cacttttgtgatgatttgcacacatgacacatgatgactgaacccattt |
2356053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #192
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 3680801 - 3680749
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||| |||| ||||||||||||||||||| ||||||||| |||| |
|
|
| T |
3680801 |
ggctaaaatatgattttgatccctgcaaatatgcctcgttttggttttggtcc |
3680749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #193
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 9175012 - 9175064
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||| |||| |||| |||||||||| |||| |||||||||||||| |
|
|
| T |
9175012 |
ggctaaaatatgattttggtccttgcaaatatgtctcgttttggttttagtcc |
9175064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #194
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 291 - 343
Target Start/End: Complemental strand, 9175256 - 9175204
Alignment:
| Q |
291 |
accccacttttgtgatgatttgcatacgtgacacattataactgaaccaattt |
343 |
Q |
| |
|
|||||||||||||||||||||||| || || ||||| || |||||||| |||| |
|
|
| T |
9175256 |
accccacttttgtgatgatttgcacacatggcacatgatgactgaacccattt |
9175204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #195
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 298 - 346
Target Start/End: Complemental strand, 10873158 - 10873110
Alignment:
| Q |
298 |
ttttgtgatgatttgcatacgtgacacattataactgaaccaattttat |
346 |
Q |
| |
|
||||||||||||||||| ||||| ||||| || |||||||| ||||||| |
|
|
| T |
10873158 |
ttttgtgatgatttgcacacgtggcacatgatgactgaacccattttat |
10873110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #196
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 13154886 - 13154938
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||| ||||| ||| ||||||||||||||| |||||||||||||| |
|
|
| T |
13154886 |
ggctaaaatatagttttgatccttgcaaatatgcctcgttttggttttagtcc |
13154938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #197
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 173 - 221
Target Start/End: Complemental strand, 13155251 - 13155203
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggtttta |
221 |
Q |
| |
|
||||| ||||||||||| || |||||||||||| |||| |||||||||| |
|
|
| T |
13155251 |
ggctaaaatatggtttttgttcctgcaaatatgtctcgttttggtttta |
13155203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #198
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 173 - 229
Target Start/End: Complemental strand, 21126021 - 21125965
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgt |
229 |
Q |
| |
|
||||| ||||| |||||||||| || ||||||| |||| |||||||||||||| ||| |
|
|
| T |
21126021 |
ggctaaaatatagttttagtccatgtaaatatgactcgttttggttttagtccctgt |
21125965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #199
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 24815068 - 24815016
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| | ||||||||||||| ||| |||||||||||||| |
|
|
| T |
24815068 |
ggctaaaatatggttttggcccctgcaaatatgtctcattttggttttagtcc |
24815016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #200
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 25600597 - 25600545
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||| ||||| ||||||||||||||| || | |||||||||||||| |
|
|
| T |
25600597 |
ggctaaaatatagttttggtccctgcaaatatgtcttgttttggttttagtcc |
25600545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #201
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 25702512 - 25702564
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| ||||||| |||||||||||| ||| ||||||||| |
|
|
| T |
25702512 |
ggctaaaatatggttttggtccctgtaaatatgcctcgttttaattttagtcc |
25702564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #202
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 179 - 223
Target Start/End: Original strand, 26530674 - 26530718
Alignment:
| Q |
179 |
aatatggttttagtccctgcaaatatgcctcggtttggttttagt |
223 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||| |||||||| |
|
|
| T |
26530674 |
aatatggttttagtccatgcaaatatgcctcattttagttttagt |
26530718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #203
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 27117753 - 27117805
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| |||||||||||||| |||| |||| ||||||||| |
|
|
| T |
27117753 |
ggctaaaatatggttttgctccctgcaaatatgtctcgttttgattttagtcc |
27117805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #204
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 173 - 229
Target Start/End: Original strand, 27341258 - 27341314
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgt |
229 |
Q |
| |
|
||||| |||||||||||| ||||||||||||||| | |||| ||||||||||||| |
|
|
| T |
27341258 |
ggctaaaatatggttttaactcctgcaaatatgccttgttttgattttagtccttgt |
27341314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #205
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 28324181 - 28324129
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| |||||| |||||||| || | |||||||||||||| |
|
|
| T |
28324181 |
ggctaaaatatggttttggtccctacaaatatgtcttgttttggttttagtcc |
28324129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #206
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 29487750 - 29487802
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||| |||| ||||||||||||||| ||| |||||||||||||| |
|
|
| T |
29487750 |
ggctaaaatatgattttcgtccctgcaaatatgtttcgttttggttttagtcc |
29487802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #207
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 173 - 209
Target Start/End: Complemental strand, 30969717 - 30969681
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctc |
209 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||||||| |
|
|
| T |
30969717 |
ggctaaaatatggttttggtccctgcaaatatgcctc |
30969681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #208
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 32040075 - 32040127
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||| | |||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
32040075 |
ggctaaaatatgatcttagtccctgcaaatatgtttcgttttggttttagtcc |
32040127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #209
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 42429758 - 42429809
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| |||||| |||||||||||| |||||||||||||| |
|
|
| T |
42429758 |
ggctaaaatatggttttggtccctacaaatatgcctc-atttggttttagtcc |
42429809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #210
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 292 - 348
Target Start/End: Complemental strand, 42430003 - 42429947
Alignment:
| Q |
292 |
ccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttatag |
348 |
Q |
| |
|
||||| ||||||||||||||||| ||||| ||||| || |||||||| |||| |||| |
|
|
| T |
42430003 |
ccccatttttgtgatgatttgcacacgtggcacatgatgactgaacccatttaatag |
42429947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #211
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 179 - 223
Target Start/End: Original strand, 43727101 - 43727145
Alignment:
| Q |
179 |
aatatggttttagtccctgcaaatatgcctcggtttggttttagt |
223 |
Q |
| |
|
|||||||||||||||||||||||||||| | | |||| ||||||| |
|
|
| T |
43727101 |
aatatggttttagtccctgcaaatatgcattgttttgattttagt |
43727145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #212
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 173 - 221
Target Start/End: Original strand, 44997931 - 44997979
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggtttta |
221 |
Q |
| |
|
||||| |||||| |||| |||||||||||||||||||| |||| ||||| |
|
|
| T |
44997931 |
ggctaaaatatgattttggtccctgcaaatatgcctcgttttgatttta |
44997979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 68; Significance: 4e-30; HSPs: 194)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 68; E-Value: 4e-30
Query Start/End: Original strand, 277 - 348
Target Start/End: Complemental strand, 294091 - 294020
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttatag |
348 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
294091 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttatag |
294020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 64; E-Value: 9e-28
Query Start/End: Original strand, 277 - 348
Target Start/End: Complemental strand, 25779060 - 25778989
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttatag |
348 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
25779060 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaactaattttatag |
25778989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 64; E-Value: 9e-28
Query Start/End: Original strand, 277 - 344
Target Start/End: Original strand, 29151618 - 29151685
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29151618 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
29151685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 64; E-Value: 9e-28
Query Start/End: Original strand, 277 - 348
Target Start/End: Original strand, 31037497 - 31037568
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttatag |
348 |
Q |
| |
|
|||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31037497 |
gaaaatagtctctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttatag |
31037568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 64; E-Value: 9e-28
Query Start/End: Original strand, 277 - 348
Target Start/End: Original strand, 38496521 - 38496592
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttatag |
348 |
Q |
| |
|
|||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38496521 |
gaaaatagtctctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttatag |
38496592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 64; E-Value: 9e-28
Query Start/End: Original strand, 277 - 344
Target Start/End: Complemental strand, 38962992 - 38962925
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38962992 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
38962925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 64; E-Value: 9e-28
Query Start/End: Original strand, 277 - 344
Target Start/End: Original strand, 42207342 - 42207409
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42207342 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
42207409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 173 - 344
Target Start/End: Complemental strand, 18633961 - 18633792
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgtnnnnnnnnnnnnnnttgtttttggtccctgcaaaannnnnnnn |
272 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |||||||||| ||| || ||||||||||||||||||||| |
|
|
| T |
18633961 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttactccctg--gtaaaaaaaaaaattgtttttggtccctgcaaaattttttgt |
18633864 |
T |
 |
| Q |
273 |
nnnngaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
18633863 |
ttttgaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaatttt |
18633792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 61; E-Value: 6e-26
Query Start/End: Original strand, 173 - 344
Target Start/End: Complemental strand, 5614530 - 5614361
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgtnnnnnnnnnnnnnnttgtttttggtccctgcaaaannnnnnnn |
272 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |||||||||||| | ||| ||||||||||||||||||||| |
|
|
| T |
5614530 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctgtaaaaagaaaatt--ttgtttttggtccctgcaaaattttttgt |
5614433 |
T |
 |
| Q |
273 |
nnnngaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||||| || ||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
5614432 |
ttttgaaaatagtccctgacaccacttttgtgatgatttgcatacgtggcacattataactgaaccaatttt |
5614361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 61; E-Value: 6e-26
Query Start/End: Original strand, 173 - 344
Target Start/End: Original strand, 28550827 - 28550994
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgtnnnnnnnnnnnnnnttgtttttggtccctgcaaaannnnnnnn |
272 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |||||||||||||| ||| ||||||||||||| ||||||| |
|
|
| T |
28550827 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgttaaaaaaaaa----ttgtttttggtccttgcaaaattttttgt |
28550922 |
T |
 |
| Q |
273 |
nnnngaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||| || ||||||||||||||||||||||| |
|
|
| T |
28550923 |
ttttgaaaatagtccctaaccccacttttgtgatgatttgcatacatggcacattataactgaaccaatttt |
28550994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 277 - 344
Target Start/End: Complemental strand, 2217756 - 2217689
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
2217756 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaatttt |
2217689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 277 - 344
Target Start/End: Complemental strand, 6118393 - 6118326
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
6118393 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaatttt |
6118326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 277 - 344
Target Start/End: Original strand, 15635477 - 15635544
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
15635477 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaatttt |
15635544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 277 - 344
Target Start/End: Complemental strand, 23382208 - 23382141
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
23382208 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataattgaaccaatttt |
23382141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 277 - 344
Target Start/End: Complemental strand, 35166058 - 35165991
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
35166058 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaatttt |
35165991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 173 - 344
Target Start/End: Complemental strand, 35167165 - 35166997
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgtnnnnnnnnnnnnnnttgtttttggtccctgcaaaannnnnnnn |
272 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |||||||||||||| || ||||||||||||| ||||||| |
|
|
| T |
35167165 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg---caaaaaaaaaatttgtttttggtccttgcaaaaatttttgt |
35167069 |
T |
 |
| Q |
273 |
nnnngaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
|||||||||| || |||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
35167068 |
ttttgaaaatagtctctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaatttt |
35166997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 174 - 344
Target Start/End: Original strand, 29172524 - 29172692
Alignment:
| Q |
174 |
gctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgtnnnnnnnnnnnnnnttgtttttggtccctgcaaaannnnnnnnn |
273 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||| |||||||||||||| || ||||||||||||| ||||||| |
|
|
| T |
29172524 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg--gtaaaaaaaaaatttgtttttggtccttgcaaaattttttgtt |
29172621 |
T |
 |
| Q |
274 |
nnngaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||||| |||||||||||||||| ||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
29172622 |
tttgaaaatagtccctgaccccacttttgtgattatttgcatacgtggcacattataactgaaccaatttt |
29172692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #18
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 173 - 344
Target Start/End: Complemental strand, 29693090 - 29692924
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgtnnnnnnnnnnnnnnttgtttttggtccctgcaaaannnnnnnn |
272 |
Q |
| |
|
||||| |||||| ||||||||||||||||||||| ||| |||||||||||||||||| ||||||||||||||| ||||| |
|
|
| T |
29693090 |
ggctaaaatatgattttagtccctgcaaatatgcttcgttttggttttagtccttgtaaaaaaaaa-----ttgtttttggtccctacaaaattttttgt |
29692996 |
T |
 |
| Q |
273 |
nnnngaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||||| ||||||||||| |||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
29692995 |
ttttgaaaatagtccctgaccccacttttatgatgatttgcatacgtggcacattataactgaaccaatttt |
29692924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #19
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 173 - 344
Target Start/End: Original strand, 36577722 - 36577888
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgtnnnnnnnnnnnnnnttgtttttggtccctgcaaaannnnnnnn |
272 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |||| |||||||||||||| ||| |||||||||| |||||||||| |
|
|
| T |
36577722 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaa-----ttgtttttggcccctgcaaaattttttgt |
36577816 |
T |
 |
| Q |
273 |
nnnngaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||||| | |||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
36577817 |
ttttgaaaatagtccctgatcccacttttgtgatgatttgcatacgtggcacattataactgaaccaatttt |
36577888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #20
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 277 - 344
Target Start/End: Original strand, 4203554 - 4203621
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
| T |
4203554 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacatattataattgaaccaatttt |
4203621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #21
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 277 - 344
Target Start/End: Complemental strand, 16038638 - 16038571
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
|||||||||| || |||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16038638 |
gaaaatagtctctgaccccacttttgtgattatttgcatacgtgacacattataactgaaccaatttt |
16038571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #22
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 277 - 344
Target Start/End: Original strand, 16616463 - 16616530
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||| | |||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
16616463 |
gaaaatagtccatgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaatttt |
16616530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #23
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 277 - 348
Target Start/End: Complemental strand, 18046250 - 18046179
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttatag |
348 |
Q |
| |
|
|||||||||| || |||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
18046250 |
gaaaatagtctctgaccccacttttgtgataatttgcatacgtgtcacattataactgaaccaattttatag |
18046179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #24
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 277 - 344
Target Start/End: Complemental strand, 27850275 - 27850208
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||||| ||||||||||||||||| |||||||||||| ||||||||||||||||||||||| |
|
|
| T |
27850275 |
gaaaatagtccctgaccccacttttgtgatggtttgcatacgtggcacattataactgaaccaatttt |
27850208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #25
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 277 - 344
Target Start/End: Original strand, 29875501 - 29875568
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||||| |||||| ||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
29875501 |
gaaaatagtcccttaccccaattttgtgatgatttgcatacgtggcacattataactgaaccaatttt |
29875568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #26
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 277 - 344
Target Start/End: Complemental strand, 37090640 - 37090573
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
|||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
37090640 |
gaaaatagtctctgaccccacttttgtgatgatttgcatacgtgacacattataactgaactaatttt |
37090573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #27
Raw Score: 54; E-Value: 8e-22
Query Start/End: Original strand, 173 - 344
Target Start/End: Original strand, 5950176 - 5950341
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgtnnnnnnnnnnnnnnttgtttttggtccctgcaaaannnnnnnn |
272 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |||||||||||||| ||| |||||||||||||||||||| |
|
|
| T |
5950176 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaa------tgtttttggtccctgcaaaattttttgt |
5950269 |
T |
 |
| Q |
273 |
nnnngaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
|||||||||| | |||||||||||||||||||||||||||||| |||||||||||||| |||||||| |
|
|
| T |
5950270 |
ttttgaaaatagtctttgaccccacttttgtgatgatttgcatacgtggcacattataactgatccaatttt |
5950341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #28
Raw Score: 54; E-Value: 8e-22
Query Start/End: Original strand, 279 - 344
Target Start/End: Complemental strand, 21125170 - 21125105
Alignment:
| Q |
279 |
aaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||| |||||||||||||||| |||||||||||||||||||||||| |||||||||||| |
|
|
| T |
21125170 |
aaatagtccctgaccccacttttgtgataatttgcatacgtgacacattataattgaaccaatttt |
21125105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #29
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 173 - 344
Target Start/End: Complemental strand, 30800850 - 30800683
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgtnnnnnnnnnnnnnnttgtttttggtccctgcaaaannnnnnnn |
272 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
30800850 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt----aattttttttttgtttttggtccctgcaaaattttttgt |
30800755 |
T |
 |
| Q |
273 |
nnnngaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||||| ||| ||||||||||| ||||||||||||| |||||||||||||||||||||| |
|
|
| T |
30800754 |
ttttgaaaatagtccctgacctgacttttgtgattatttgcatacgtggtacattataactgaaccaatttt |
30800683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #30
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 173 - 344
Target Start/End: Original strand, 30888160 - 30888329
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgtnnnnnnnnnnnnnnttgtttttggtccctgcaaaannnnnnnn |
272 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||| |||| |||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
30888160 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtagaatttttttt--ttgtttttggtccctgcaaaattttttgt |
30888257 |
T |
 |
| Q |
273 |
nnnngaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||| || ||||||||||||||||||||||| |
|
|
| T |
30888258 |
ttttgaaaatagtccctgaccccacttttgtgatgatttgcatatatggcacattataactgaaccaatttt |
30888329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #31
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 173 - 344
Target Start/End: Complemental strand, 33336026 - 33335856
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgtnnnnnnnnnnnnnnttgtttttggtccctgcaaaannnnnnnn |
272 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |||| |||||||||||||| ||| |||||||||||| |||||||| |
|
|
| T |
33336026 |
ggctaaaatatggttttagtccctgcaaatatgactcgttttggttttagtccctgtaaaaaaaaaaaaa-ttgtttttggtcgctgcaaaattttttgt |
33335928 |
T |
 |
| Q |
273 |
nnnngaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||| | |||||||||||||||| ||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
33335927 |
ttttgaaaatagtccttgaccccacttttgtgattatttgcatacgtgacacattataactgaatcaatttt |
33335856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #32
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 277 - 344
Target Start/End: Original strand, 10409033 - 10409099
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||||| |||| |||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
10409033 |
gaaaatagtccctgaccc-acttttgtgatgatttgcatacgtgacacattataactaaaccaatttt |
10409099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #33
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 277 - 344
Target Start/End: Original strand, 21050675 - 21050742
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||| | ||| |||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
21050675 |
gaaaatagtccttgacctcacttttgtgatgatttgcatacgtggcacattataactgaaccaatttt |
21050742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #34
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 173 - 339
Target Start/End: Original strand, 38786159 - 38786321
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgtnnnnnnnnnnnnnnttgtttttggtccctgcaaaannnnnnnn |
272 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| ||| |||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
38786159 |
ggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctgtaaaaaaaaaa----ttgtttttggtccctgcaaaattttttgt |
38786254 |
T |
 |
| Q |
273 |
nnnngaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaacca |
339 |
Q |
| |
|
|||||||||| || ||| || |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38786255 |
ttttgaaaatagtctctgacctcatttttgtgatgatttgcatacgtgacacattataactgaacca |
38786321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #35
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 277 - 344
Target Start/End: Original strand, 39379330 - 39379397
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
|||||||||||| | ||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39379330 |
gaaaatagtcccggatcccacttttatgatgatttgcatacgtgacacattataactgaaccaatttt |
39379397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #36
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 173 - 229
Target Start/End: Original strand, 10743724 - 10743780
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgt |
229 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
10743724 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccttgt |
10743780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #37
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 173 - 229
Target Start/End: Original strand, 16038377 - 16038433
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgt |
229 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
16038377 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccttgt |
16038433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #38
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 173 - 229
Target Start/End: Complemental strand, 18046348 - 18046292
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgt |
229 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
18046348 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccttgt |
18046292 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #39
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 277 - 344
Target Start/End: Complemental strand, 7075860 - 7075793
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||||| | ||||||||||||||||||||||| ||| ||||||||||||||||||||||| |
|
|
| T |
7075860 |
gaaaatagtccctggctccacttttgtgatgatttgcatatgtggcacattataactgaaccaatttt |
7075793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #40
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 277 - 344
Target Start/End: Original strand, 40029240 - 40029307
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||||| || ||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
40029240 |
gaaaatagtccctaactccacttttgtgatgattgatatacgtgacacattataactgaaccaatttt |
40029307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #41
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 173 - 344
Target Start/End: Complemental strand, 28863838 - 28863666
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgt-nnnnnnnnnnnnnnttgtttttggtccctgcaaaannnnnnn |
271 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
28863838 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaatatatattgtttttggtccctgcaaaattttttg |
28863739 |
T |
 |
| Q |
272 |
nnnnngaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
|||||||||||| |||||| ||||||||||||||||||||||| ||||| || |||||||| ||||| |
|
|
| T |
28863738 |
ttttttaaaatagtccctgaccccatttttgtgatgatttgcatacgtgtcacatgatgactgaaccgatttt |
28863666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #42
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 2217494 - 2217546
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
2217494 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
2217546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #43
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 2217854 - 2217802
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
2217854 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
2217802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #44
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 7075572 - 7075624
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
7075572 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
7075624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #45
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 173 - 229
Target Start/End: Complemental strand, 13990895 - 13990839
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgt |
229 |
Q |
| |
|
||||| |||| ||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
13990895 |
ggctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccttgt |
13990839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #46
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 18633599 - 18633651
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
18633599 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
18633651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #47
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 173 - 229
Target Start/End: Original strand, 20660948 - 20661004
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgt |
229 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
20660948 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccttgt |
20661004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #48
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 28863510 - 28863562
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
28863510 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
28863562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #49
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 29172886 - 29172834
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
29172886 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
29172834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #50
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 29692744 - 29692796
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
29692744 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
29692796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #51
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 29875725 - 29875673
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
29875725 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
29875673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #52
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 30800494 - 30800546
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
30800494 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
30800546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #53
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 173 - 229
Target Start/End: Original strand, 34125307 - 34125363
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgt |
229 |
Q |
| |
|
||||| ||||| |||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
34125307 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccttgt |
34125363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #54
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 36578083 - 36578031
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
36578083 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
36578031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #55
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 40029497 - 40029445
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
40029497 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
40029445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #56
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 277 - 344
Target Start/End: Complemental strand, 14318300 - 14318233
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||||| |||| | ||||||||||||||||||||||||||||| || |||||||| ||||| |
|
|
| T |
14318300 |
gaaaatagtccctgaccctatttttgtgatgatttgcatacgtgacacatgatgactgaacccatttt |
14318233 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #57
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 173 - 228
Target Start/End: Complemental strand, 39379610 - 39379555
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttg |
228 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
39379610 |
ggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccttg |
39379555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #58
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 173 - 223
Target Start/End: Original strand, 4203456 - 4203506
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagt |
223 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
4203456 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
4203506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #59
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 179 - 229
Target Start/End: Complemental strand, 9532529 - 9532479
Alignment:
| Q |
179 |
aatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgt |
229 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| |||||||||||||||||| |
|
|
| T |
9532529 |
aatatggttttagtccttgcaaatatgcctcgttttggttttagtccttgt |
9532479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #60
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 278 - 344
Target Start/End: Original strand, 27916564 - 27916630
Alignment:
| Q |
278 |
aaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
|||||||||||| |||||| ||||||||| |||||||||||||||| || || |||||||||||||| |
|
|
| T |
27916564 |
aaaatagtccctgaccccatttttgtgataatttgcatacgtgacagatgatgactgaaccaatttt |
27916630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #61
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 173 - 226
Target Start/End: Complemental strand, 23382297 - 23382244
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcct |
226 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||| | ||||||||||||||| |
|
|
| T |
23382297 |
ggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtcct |
23382244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #62
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 293828 - 293880
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |||| ||||||||| |
|
|
| T |
293828 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtcc |
293880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #63
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 1105148 - 1105096
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
1105148 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
1105096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #64
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 1381611 - 1381559
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
1381611 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
1381559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #65
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 174 - 226
Target Start/End: Complemental strand, 2636992 - 2636940
Alignment:
| Q |
174 |
gctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcct |
226 |
Q |
| |
|
|||| ||||||||||| |||||||||||||||||||| ||||||||||||||| |
|
|
| T |
2636992 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcct |
2636940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #66
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 229
Target Start/End: Original strand, 5614166 - 5614222
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgt |
229 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |||| |||| ||||||||||||| |
|
|
| T |
5614166 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccttgt |
5614222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #67
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 5917460 - 5917408
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
5917460 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
5917408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #68
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 6118499 - 6118447
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |||||||||| ||| |
|
|
| T |
6118499 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttaatcc |
6118447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #69
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 6912497 - 6912549
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
6912497 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
6912549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #70
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 10408928 - 10408980
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |||| ||||||||| |
|
|
| T |
10408928 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtcc |
10408980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #71
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 11799458 - 11799406
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
11799458 |
ggctaaaatatggttttagtccgtgcaaatatgcctcgttttggttttagtcc |
11799406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #72
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 229
Target Start/End: Original strand, 14318045 - 14318101
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgt |
229 |
Q |
| |
|
||||| |||||||||||||||| |||||||||| |||| |||||||||||||||||| |
|
|
| T |
14318045 |
ggctaaaatatggttttagtccttgcaaatatgtctcgttttggttttagtccttgt |
14318101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #73
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 15635707 - 15635655
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||||||||| |||||||||||||| |||||||||||||| |
|
|
| T |
15635707 |
ggctaaaatatggttttagtccccgcaaatatgcctcgttttggttttagtcc |
15635655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #74
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 229
Target Start/End: Complemental strand, 18258527 - 18258471
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgt |
229 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||| |||| |||||||||||||||||| |
|
|
| T |
18258527 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccttgt |
18258471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #75
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 19565831 - 19565779
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
19565831 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
19565779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #76
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 19685380 - 19685328
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
19685380 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
19685328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #77
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 24443744 - 24443692
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
24443744 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
24443692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #78
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 25561705 - 25561757
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
25561705 |
ggctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagtcc |
25561757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #79
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 221
Target Start/End: Complemental strand, 25561999 - 25561951
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggtttta |
221 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
25561999 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
25561951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #80
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 26133183 - 26133235
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||||||||||||||| ||||||||||||| |||||||||||||| |
|
|
| T |
26133183 |
ggctaaaatatggttttagtccctacaaatatgcctcgttttggttttagtcc |
26133235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #81
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 26133413 - 26133361
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |||| |||||||||||||| |
|
|
| T |
26133413 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
26133361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #82
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 35928064 - 35928116
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
35928064 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
35928116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #83
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 38170514 - 38170566
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
38170514 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
38170566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #84
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 181 - 225
Target Start/End: Original strand, 40167794 - 40167838
Alignment:
| Q |
181 |
tatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
40167794 |
tatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
40167838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #85
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 40764415 - 40764467
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
40764415 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
40764467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #86
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 173 - 224
Target Start/End: Complemental strand, 10409326 - 10409275
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtc |
224 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |||| |||||||| |
|
|
| T |
10409326 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtc |
10409275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #87
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 278 - 344
Target Start/End: Complemental strand, 3850525 - 3850459
Alignment:
| Q |
278 |
aaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
|||||||||| | |||||| ||||||||||||||||||||||| ||||| || |||||||| ||||| |
|
|
| T |
3850525 |
aaaatagtccttgaccccatttttgtgatgatttgcatacgtggcacatgatgactgaacccatttt |
3850459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #88
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 179 - 225
Target Start/End: Complemental strand, 3850593 - 3850547
Alignment:
| Q |
179 |
aatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||||||||||||||||||||||||| |||| |||||||||||||| |
|
|
| T |
3850593 |
aatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
3850547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #89
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 278 - 344
Target Start/End: Complemental strand, 10743953 - 10743887
Alignment:
| Q |
278 |
aaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
|||||||||||| |||||| ||||||||||||||||||| ||| ||||| || |||||||| ||||| |
|
|
| T |
10743953 |
aaaatagtccctgaccccatttttgtgatgatttgcatatgtgtcacatgatgactgaaccgatttt |
10743887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #90
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 179 - 225
Target Start/End: Original strand, 20985731 - 20985777
Alignment:
| Q |
179 |
aatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
20985731 |
aatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
20985777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #91
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 173 - 223
Target Start/End: Complemental strand, 29151851 - 29151801
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagt |
223 |
Q |
| |
|
||||| |||||||||||||| ||||||||||||||||| |||||||||||| |
|
|
| T |
29151851 |
ggctaaaatatggttttagttcctgcaaatatgcctcgttttggttttagt |
29151801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #92
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 278 - 348
Target Start/End: Complemental strand, 29366847 - 29366777
Alignment:
| Q |
278 |
aaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttatag |
348 |
Q |
| |
|
|||||| ||||| |||||| |||||||||||||| |||||||||||||| || | |||||| ||||||||| |
|
|
| T |
29366847 |
aaaataatccctgaccccatttttgtgatgatttacatacgtgacacatgatgattgaacctattttatag |
29366777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #93
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 173 - 223
Target Start/End: Complemental strand, 29366949 - 29366899
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagt |
223 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |||| |||||||||||| |
|
|
| T |
29366949 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt |
29366899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #94
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 179 - 225
Target Start/End: Original strand, 39379245 - 39379291
Alignment:
| Q |
179 |
aatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
|||||| ||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
39379245 |
aatatgattttagtccctgcaaatatgcctcgttttggttttagtcc |
39379291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #95
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 179 - 224
Target Start/End: Complemental strand, 16038734 - 16038689
Alignment:
| Q |
179 |
aatatggttttagtccctgcaaatatgcctcggtttggttttagtc |
224 |
Q |
| |
|
|||||| ||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
16038734 |
aatatgattttagtccctgcaaatatgcctcgttttggttttagtc |
16038689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #96
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 179 - 224
Target Start/End: Complemental strand, 27916758 - 27916713
Alignment:
| Q |
179 |
aatatggttttagtccctgcaaatatgcctcggtttggttttagtc |
224 |
Q |
| |
|
|||||||||||| ||||||||||||||||||| ||||||||||||| |
|
|
| T |
27916758 |
aatatggttttattccctgcaaatatgcctcgttttggttttagtc |
27916713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #97
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 173 - 222
Target Start/End: Original strand, 35166911 - 35166960
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttag |
222 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||| | ||||||||||| |
|
|
| T |
35166911 |
ggctaaaatatggttttagtccctgcaaatatgccttgttttggttttag |
35166960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #98
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 45138 - 45190
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||| |||| |||||||||||||| |
|
|
| T |
45138 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
45190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #99
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 1104858 - 1104910
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||||||| |||| ||||||||| |
|
|
| T |
1104858 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttgattttagtcc |
1104910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #100
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 1381247 - 1381299
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||| |||| |||||||||||||| |
|
|
| T |
1381247 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
1381299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #101
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 181 - 225
Target Start/End: Complemental strand, 2032932 - 2032888
Alignment:
| Q |
181 |
tatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||||||||||||||||||||||| |||| |||||||||||||| |
|
|
| T |
2032932 |
tatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
2032888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #102
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 4203770 - 4203718
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |||| |||| ||||||||| |
|
|
| T |
4203770 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtcc |
4203718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #103
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 295 - 343
Target Start/End: Complemental strand, 5904253 - 5904205
Alignment:
| Q |
295 |
cacttttgtgatgatttgcatacgtgacacattataactgaaccaattt |
343 |
Q |
| |
|
||||||||||||||||||||||||||||| || ||||||||||| |||| |
|
|
| T |
5904253 |
cacttttgtgatgatttgcatacgtgacatatgataactgaacccattt |
5904205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #104
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 5917126 - 5917178
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||| |||| |||||||||||||| |
|
|
| T |
5917126 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
5917178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #105
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 221
Target Start/End: Complemental strand, 9179920 - 9179872
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggtttta |
221 |
Q |
| |
|
||||| |||||||||||||||| ||||||||||||||| |||||||||| |
|
|
| T |
9179920 |
ggctaaaatatggttttagtccttgcaaatatgcctcgttttggtttta |
9179872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #106
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 10744054 - 10744002
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||||||||||||| |||||||||| |||| |||||||||||||| |
|
|
| T |
10744054 |
ggctaaaatatggttttagtccttgcaaatatgtctcgttttggttttagtcc |
10744002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #107
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 11799129 - 11799181
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| | | |||||||||||||| |
|
|
| T |
11799129 |
ggctaaaatatggttttagtccctgcaaatatgcattgttttggttttagtcc |
11799181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #108
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 18046038 - 18046090
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |||| |||| ||||||||| |
|
|
| T |
18046038 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtcc |
18046090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #109
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 19565467 - 19565519
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||| |||| |||||||||||||| |
|
|
| T |
19565467 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
19565519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #110
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 19685017 - 19685069
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||| |||| |||||||||||||| |
|
|
| T |
19685017 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
19685069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #111
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 20986089 - 20986037
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||||||| |||| ||||||||| |
|
|
| T |
20986089 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttgattttagtcc |
20986037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #112
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 21050913 - 21050861
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| ||| |||| ||||||||| |
|
|
| T |
21050913 |
ggctaaaatatggttttagtccctgcaaatatgcatcgttttgattttagtcc |
21050861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #113
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 21124913 - 21124965
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||||||||| |||||||||||||| |||| |||||||||||||| |
|
|
| T |
21124913 |
ggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtcc |
21124965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #114
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 24443380 - 24443432
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
24443380 |
ggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtcc |
24443432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #115
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 24781989 - 24782041
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||||||| ||||||||||| |||| |||||||||||||| |
|
|
| T |
24781989 |
ggctaaaatatggttttagtcactgcaaatatgtctcgttttggttttagtcc |
24782041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #116
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 28213373 - 28213425
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
28213373 |
ggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtcc |
28213425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #117
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 29151516 - 29151568
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||| ||||||||||||||||||||||||| |||| ||||||||| |
|
|
| T |
29151516 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttgattttagtcc |
29151568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #118
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 29875400 - 29875452
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||| ||||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
29875400 |
ggctaaaatatgattttaatccctgcaaatatgcctcgttttggttttagtcc |
29875452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #119
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 221
Target Start/End: Complemental strand, 31037741 - 31037693
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggtttta |
221 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |||| |||||||||| |
|
|
| T |
31037741 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
31037693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #120
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 34125632 - 34125580
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||||||||||| ||||||||||| |||||||||||||| |
|
|
| T |
34125632 |
ggctaaaatatggttttagtccctgtaaatatgcctcattttggttttagtcc |
34125580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #121
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 35166158 - 35166106
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||||||||||||||| ||| |||| |||||||||||||| |
|
|
| T |
35166158 |
ggctataatatggttttagtccctgcaaaaatgtctcgttttggttttagtcc |
35166106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #122
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 35876688 - 35876740
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||| ||| |||||||||||||| |
|
|
| T |
35876688 |
ggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtcc |
35876740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #123
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 35928458 - 35928406
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||| |||| |||||||||||||| |
|
|
| T |
35928458 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
35928406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #124
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 37271359 - 37271411
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| ||| |||||||||||||||| |||||||||||||| |
|
|
| T |
37271359 |
ggctaaaatatggttttggtctctgcaaatatgcctcgttttggttttagtcc |
37271411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #125
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 38496782 - 38496730
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
38496782 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttagtcc |
38496730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #126
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 229
Target Start/End: Original strand, 38962806 - 38962862
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgt |
229 |
Q |
| |
|
||||| ||||||||||||||||||| ||||||| |||| |||||||||||| ||||| |
|
|
| T |
38962806 |
ggctaaaatatggttttagtccctgtaaatatgtctcgttttggttttagttcttgt |
38962862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #127
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 40764780 - 40764728
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
40764780 |
ggctaaaatatggttttgctccctgcaaatatgcctcgttttggttttagtcc |
40764728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #128
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 173 - 220
Target Start/End: Original strand, 3850299 - 3850346
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggtttt |
220 |
Q |
| |
|
||||| |||||||||||||||||||||||| ||||||| ||||||||| |
|
|
| T |
3850299 |
ggctaaaatatggttttagtccctgcaaatctgcctcgttttggtttt |
3850346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #129
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 284 - 343
Target Start/End: Original strand, 10830638 - 10830697
Alignment:
| Q |
284 |
gtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattt |
343 |
Q |
| |
|
|||||| |||||||||||||||||||||||| |||||||||| || |||||||| |||| |
|
|
| T |
10830638 |
gtccctgaccccacttttgtgatgatttgcacacgtgacacaagatgactgaacccattt |
10830697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #130
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 173 - 224
Target Start/End: Original strand, 20690733 - 20690784
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtc |
224 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||| |||| ||||||||||||| |
|
|
| T |
20690733 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
20690784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #131
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 277 - 344
Target Start/End: Complemental strand, 24782175 - 24782108
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
|||||||||| || |||| || ||||||||||||||||||||| | ||||||| ||||||||||||| |
|
|
| T |
24782175 |
gaaaatagtctctgaccctgctgttgtgatgatttgcatacgtggcgcattatatctgaaccaatttt |
24782108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #132
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 292 - 343
Target Start/End: Original strand, 28213490 - 28213541
Alignment:
| Q |
292 |
ccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattt |
343 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| || |||||||| |||| |
|
|
| T |
28213490 |
ccccacttttgtgatgatttgcacacgtgacacatgatgactgaacccattt |
28213541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #133
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 179 - 225
Target Start/End: Complemental strand, 6912851 - 6912805
Alignment:
| Q |
179 |
aatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||||||||| ||||||||||||||| |||| |||||||||||||| |
|
|
| T |
6912851 |
aatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
6912805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #134
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 173 - 223
Target Start/End: Complemental strand, 18286741 - 18286691
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagt |
223 |
Q |
| |
|
||||| || ||||||||||||||||||||||| ||||| |||||||||||| |
|
|
| T |
18286741 |
ggctaaaaaatggttttagtccctgcaaatatacctcgttttggttttagt |
18286691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #135
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 284 - 326
Target Start/End: Original strand, 20661057 - 20661099
Alignment:
| Q |
284 |
gtccctcaccccacttttgtgatgatttgcatacgtgacacat |
326 |
Q |
| |
|
|||||| |||||||||||||||||||||||| ||||||||||| |
|
|
| T |
20661057 |
gtccctgaccccacttttgtgatgatttgcacacgtgacacat |
20661099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #136
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 173 - 223
Target Start/End: Original strand, 23381950 - 23382000
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagt |
223 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| || | |||||||||||| |
|
|
| T |
23381950 |
ggctaaaatatggttttagtccctgcaaatatgtctggttttggttttagt |
23382000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #137
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 173 - 223
Target Start/End: Complemental strand, 25779162 - 25779112
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagt |
223 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| || |||||||||||| |
|
|
| T |
25779162 |
ggctaaaatatggttttagtccctgcaaatatgcttcattttggttttagt |
25779112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #138
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 179 - 225
Target Start/End: Complemental strand, 28108156 - 28108110
Alignment:
| Q |
179 |
aatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||||||||| |||||| ||||||||||||| |||||||||||||| |
|
|
| T |
28108156 |
aatatggttttggtccctacaaatatgcctcgttttggttttagtcc |
28108110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #139
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 181 - 223
Target Start/End: Complemental strand, 28871986 - 28871944
Alignment:
| Q |
181 |
tatggttttagtccctgcaaatatgcctcggtttggttttagt |
223 |
Q |
| |
|
||||||||| |||||||||||||||||||| |||||||||||| |
|
|
| T |
28871986 |
tatggttttggtccctgcaaatatgcctcgttttggttttagt |
28871944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #140
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 179 - 224
Target Start/End: Original strand, 16616374 - 16616419
Alignment:
| Q |
179 |
aatatggttttagtccctgcaaatatgcctcggtttggttttagtc |
224 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||| ||||||||| |
|
|
| T |
16616374 |
aatatggttttagtccctgcaaatatgcctcattttagttttagtc |
16616419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #141
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 294 - 343
Target Start/End: Original strand, 35609392 - 35609441
Alignment:
| Q |
294 |
ccacttttgtgatgatttgcatacgtgacacattataactgaaccaattt |
343 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| || |||||||| |||| |
|
|
| T |
35609392 |
ccacttttgtgatgatttgcacacgtgacacatgatgactgaacccattt |
35609441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #142
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 173 - 222
Target Start/End: Complemental strand, 35877052 - 35877003
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttag |
222 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||| |||| ||||||||||| |
|
|
| T |
35877052 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttag |
35877003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #143
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 1286682 - 1286734
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||||| || |||||| ||||||||||||| |||||||||||||| |
|
|
| T |
1286682 |
ggctaaaatatggtgttggtccctacaaatatgcctcgttttggttttagtcc |
1286734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #144
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 4736542 - 4736490
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||| ||| |||||||||||||| |
|
|
| T |
4736542 |
ggctaaaatatggttttggtccctgcaaatatgtttcgttttggttttagtcc |
4736490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #145
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 9179593 - 9179645
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||||||||||||| |||||||||| ||| |||||||||||||| |
|
|
| T |
9179593 |
ggctaaaatatggttttagtccttgcaaatatgattcgttttggttttagtcc |
9179645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #146
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 12144907 - 12144959
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| ||||||| ||||||||||| |||||||||||||| |
|
|
| T |
12144907 |
ggctaaaatatggtttttgtccctgtaaatatgcctctttttggttttagtcc |
12144959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #147
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 18258162 - 18258214
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||| ||| |||||||||||||| |
|
|
| T |
18258162 |
ggctaaaatatggttttggtccctgcaaatatggctcattttggttttagtcc |
18258214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #148
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 20416360 - 20416412
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||| |||| |||||||| ||||| |
|
|
| T |
20416360 |
ggctaaaatatggttttcgtccctgcaaatatgtctcgctttggtttaagtcc |
20416412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #149
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 20661311 - 20661259
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| |||| ||||||||||| ||| |||||||||||||| |
|
|
| T |
20661311 |
ggctaaaatatggttttggtccgtgcaaatatgcttcgttttggttttagtcc |
20661259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #150
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 20683747 - 20683799
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||||||| |||||||||||| ||| |||| ||||||||| |
|
|
| T |
20683747 |
ggctaaaatatggttttagtctctgcaaatatgcatcgttttgattttagtcc |
20683799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #151
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 292 - 344
Target Start/End: Original strand, 31602264 - 31602316
Alignment:
| Q |
292 |
ccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||||||||||||||| ||||| ||||| |||| |||||| ||||| |
|
|
| T |
31602264 |
ccccacttttgtgatgatttgcacacgtggcacatgataattgaacccatttt |
31602316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #152
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 35609303 - 35609355
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| |||| ||||||||||| ||| |||||||||||||| |
|
|
| T |
35609303 |
ggctaaaatatggttttggtccatgcaaatatgcatcgttttggttttagtcc |
35609355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #153
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 179 - 223
Target Start/End: Complemental strand, 35609631 - 35609587
Alignment:
| Q |
179 |
aatatggttttagtccctgcaaatatgcctcggtttggttttagt |
223 |
Q |
| |
|
||||||||||| ||||||||||||||| |||| |||||||||||| |
|
|
| T |
35609631 |
aatatggttttggtccctgcaaatatgtctcgttttggttttagt |
35609587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #154
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 37271706 - 37271654
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||| |||| |||| ||||||||| |
|
|
| T |
37271706 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttgattttagtcc |
37271654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #155
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 173 - 221
Target Start/End: Original strand, 40029141 - 40029189
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggtttta |
221 |
Q |
| |
|
||||| ||||||||||||||||||| ||||||| |||| |||||||||| |
|
|
| T |
40029141 |
ggctaaaatatggttttagtccctgtaaatatgtctcgttttggtttta |
40029189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #156
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 40168008 - 40167956
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||| |||||||||| |||||||||| |||| |||||||||||||| |
|
|
| T |
40168008 |
ggctaaaatattgttttagtccatgcaaatatgtctcgttttggttttagtcc |
40167956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #157
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 42207242 - 42207294
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||||||||||||| || ||||||| |||| |||||||||||||| |
|
|
| T |
42207242 |
ggctaaaatatggttttagtccttgtaaatatgtctcgttttggttttagtcc |
42207294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #158
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 173 - 221
Target Start/End: Original strand, 42994068 - 42994116
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggtttta |
221 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |||| |||| ||||| |
|
|
| T |
42994068 |
ggctaaaatatggttttagtccctgcaaatatgactcgttttgatttta |
42994116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #159
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 292 - 343
Target Start/End: Complemental strand, 1286930 - 1286879
Alignment:
| Q |
292 |
ccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattt |
343 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| || |||||||| |||| |
|
|
| T |
1286930 |
ccccacttttgtgatgatttgcaagcgtgacacataatgactgaacccattt |
1286879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #160
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 173 - 224
Target Start/End: Original strand, 2636669 - 2636720
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtc |
224 |
Q |
| |
|
||||| ||||||||||| ||||||||||||| | |||| ||||||||||||| |
|
|
| T |
2636669 |
ggctaaaatatggttttggtccctgcaaatacgtctcgttttggttttagtc |
2636720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #161
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 281 - 344
Target Start/End: Complemental strand, 3850719 - 3850656
Alignment:
| Q |
281 |
atagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
|||||| || |||||| || |||||||||||||||||||| ||||| || |||||||| ||||| |
|
|
| T |
3850719 |
atagtctctgaccccatttatgtgatgatttgcatacgtggcacatgatgactgaacccatttt |
3850656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #162
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 278 - 337
Target Start/End: Complemental strand, 22551214 - 22551155
Alignment:
| Q |
278 |
aaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaac |
337 |
Q |
| |
|
|||||||||||| |||||||||||||||||| |||||||||| |||| || ||||||| |
|
|
| T |
22551214 |
aaaatagtccctgaccccacttttgtgatgagctgcatacgtggtacatgatgactgaac |
22551155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #163
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 173 - 224
Target Start/End: Original strand, 42553642 - 42553693
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtc |
224 |
Q |
| |
|
||||| |||||| |||| ||||||||||||||| |||| ||||||||||||| |
|
|
| T |
42553642 |
ggctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagtc |
42553693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #164
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 293 - 343
Target Start/End: Complemental strand, 5103892 - 5103842
Alignment:
| Q |
293 |
cccacttttgtgatgatttgcatacgtgacacattataactgaaccaattt |
343 |
Q |
| |
|
|||||||||||||||||||||| | ||||||||| || |||||||| |||| |
|
|
| T |
5103892 |
cccacttttgtgatgatttgcacatgtgacacatgatgactgaacccattt |
5103842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #165
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 180 - 225
Target Start/End: Original strand, 6118139 - 6118185
Alignment:
| Q |
180 |
atatggttttagtccctgcaaatatgcctcggttt-ggttttagtcc |
225 |
Q |
| |
|
|||||||||||||| |||||||||||||||| ||| ||||||||||| |
|
|
| T |
6118139 |
atatggttttagtctctgcaaatatgcctcgttttgggttttagtcc |
6118185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #166
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 278 - 348
Target Start/End: Complemental strand, 9179820 - 9179750
Alignment:
| Q |
278 |
aaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttatag |
348 |
Q |
| |
|
||||||||| | |||||| | |||||||||||||| |||||| ||||| ||||| ||||| ||||||||| |
|
|
| T |
9179820 |
aaaatagtctccgaccccattattgtgatgatttgcctacgtggcacatgataaccgaacctattttatag |
9179750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #167
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 292 - 326
Target Start/End: Original strand, 9532306 - 9532340
Alignment:
| Q |
292 |
ccccacttttgtgatgatttgcatacgtgacacat |
326 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||| |
|
|
| T |
9532306 |
ccccatttttgtgatgatttgcatacgtgacacat |
9532340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #168
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 278 - 344
Target Start/End: Original strand, 13990708 - 13990774
Alignment:
| Q |
278 |
aaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
|||||||||| | |||| | ||||||||||||||||||||||| ||||| || ||| |||| ||||| |
|
|
| T |
13990708 |
aaaatagtccatgaccctatttttgtgatgatttgcatacgtggcacatgatgactcaacccatttt |
13990774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #169
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 179 - 225
Target Start/End: Original strand, 15635382 - 15635428
Alignment:
| Q |
179 |
aatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
|||||||||||||||| |||||||||| || | |||||||||||||| |
|
|
| T |
15635382 |
aatatggttttagtccatgcaaatatgtcttgttttggttttagtcc |
15635428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #170
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 179 - 229
Target Start/End: Original strand, 18286434 - 18286484
Alignment:
| Q |
179 |
aatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgt |
229 |
Q |
| |
|
|||||||||||||| |||||||||||| || | |||||||||| ||||||| |
|
|
| T |
18286434 |
aatatggttttagttcctgcaaatatgtcttgttttggttttaatccttgt |
18286484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #171
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 284 - 326
Target Start/End: Original strand, 20690840 - 20690882
Alignment:
| Q |
284 |
gtccctcaccccacttttgtgatgatttgcatacgtgacacat |
326 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||| || ||||| |
|
|
| T |
20690840 |
gtccctgaccccacttttgtgatgatttgcatacatggcacat |
20690882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #172
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 179 - 225
Target Start/End: Complemental strand, 27850368 - 27850322
Alignment:
| Q |
179 |
aatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
|||||| |||||||| ||||||||||| |||| |||||||||||||| |
|
|
| T |
27850368 |
aatatgattttagtctctgcaaatatgtctcgttttggttttagtcc |
27850322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #173
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 179 - 225
Target Start/End: Original strand, 32888693 - 32888739
Alignment:
| Q |
179 |
aatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||||||||| |||||||||||||| ||||| ||| |||||||||| |
|
|
| T |
32888693 |
aatatggttttggtccctgcaaatattcctcgttttcgttttagtcc |
32888739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #174
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 294 - 336
Target Start/End: Original strand, 36973472 - 36973514
Alignment:
| Q |
294 |
ccacttttgtgatgatttgcatacgtgacacattataactgaa |
336 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| || |||||| |
|
|
| T |
36973472 |
ccacttttgtgatgatttgcacacgtgacacatgatgactgaa |
36973514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #175
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 179 - 225
Target Start/End: Complemental strand, 42207566 - 42207521
Alignment:
| Q |
179 |
aatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
|||||||||||||||| | ||||||||||||| |||||||||||||| |
|
|
| T |
42207566 |
aatatggttttagtcc-tacaaatatgcctcgttttggttttagtcc |
42207521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #176
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 293 - 343
Target Start/End: Original strand, 42596571 - 42596621
Alignment:
| Q |
293 |
cccacttttgtgatgatttgcatacgtgacacattataactgaaccaattt |
343 |
Q |
| |
|
|||||||||||||||||||| | || |||||||| ||||||||||| |||| |
|
|
| T |
42596571 |
cccacttttgtgatgatttggacacatgacacatgataactgaacccattt |
42596621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #177
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 179 - 225
Target Start/End: Complemental strand, 42596811 - 42596765
Alignment:
| Q |
179 |
aatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||||||||| ||||||||||||||| |||| ||| |||||||||| |
|
|
| T |
42596811 |
aatatggttttggtccctgcaaatatgactcgttttagttttagtcc |
42596765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #178
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 173 - 222
Target Start/End: Complemental strand, 17070863 - 17070814
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttag |
222 |
Q |
| |
|
||||| |||||||||||||||||| |||||||| |||| ||| ||||||| |
|
|
| T |
17070863 |
ggctaaaatatggttttagtccctacaaatatgtctcgttttcgttttag |
17070814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #179
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 282 - 343
Target Start/End: Original strand, 26071397 - 26071458
Alignment:
| Q |
282 |
tagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattt |
343 |
Q |
| |
|
||||| || |||||||||||||||||||||||| |||| ||||| || |||||||| |||| |
|
|
| T |
26071397 |
tagtctctgaccccacttttgtgatgatttgcacacgtagcacatgatgactgaacccattt |
26071458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #180
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 179 - 224
Target Start/End: Original strand, 31037401 - 31037446
Alignment:
| Q |
179 |
aatatggttttagtccctgcaaatatgcctcggtttggttttagtc |
224 |
Q |
| |
|
|||||||||||||||||||||||||| ||| | |||| |||||||| |
|
|
| T |
31037401 |
aatatggttttagtccctgcaaatataccttgttttgattttagtc |
31037446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #181
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 294 - 343
Target Start/End: Original strand, 32108926 - 32108975
Alignment:
| Q |
294 |
ccacttttgtgatgatttgcatacgtgacacattataactgaaccaattt |
343 |
Q |
| |
|
||||||||||||||||||||| ||||| ||||| || |||||||| |||| |
|
|
| T |
32108926 |
ccacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt |
32108975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #182
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 294 - 343
Target Start/End: Original strand, 40038614 - 40038663
Alignment:
| Q |
294 |
ccacttttgtgatgatttgcatacgtgacacattataactgaaccaattt |
343 |
Q |
| |
|
||||||||||||||||||||| ||||| ||||| || |||||||| |||| |
|
|
| T |
40038614 |
ccacttttgtgatgatttgcacacgtggcacatgatgactgaacctattt |
40038663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #183
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 3851329 - 3851277
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||||||||||||||| ||||||| |||| |||| ||||||||| |
|
|
| T |
3851329 |
ggctaaaatatggttttagtccctcaaaatatgtctcgttttgattttagtcc |
3851277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #184
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 5904008 - 5904060
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| ||| ||||||||||||||| |||| ||||||||| |
|
|
| T |
5904008 |
ggctaaaatatggttttgctccttgcaaatatgcctcgttttgattttagtcc |
5904060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #185
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 15916286 - 15916338
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| || |||||||| ||||||||||||||| ||| |||||||||||||| |
|
|
| T |
15916286 |
ggctaaaagatggttttggtccctgcaaatatgtctcattttggttttagtcc |
15916338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #186
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 284 - 348
Target Start/End: Original strand, 15916395 - 15916458
Alignment:
| Q |
284 |
gtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttatag |
348 |
Q |
| |
|
|||||| ||| |||||||||||||||||||| | |||||||| ||| | |||||| ||||||||| |
|
|
| T |
15916395 |
gtccctgacctcacttttgtgatgatttgcacatgtgacaca-tatgaatgaacccattttatag |
15916458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #187
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 17070535 - 17070586
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||| ||| ||||| ||||||||| |
|
|
| T |
17070535 |
ggctaaaatatggttttggtccctgcaaatatgtctc-gtttgattttagtcc |
17070586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #188
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 286 - 326
Target Start/End: Original strand, 17070646 - 17070686
Alignment:
| Q |
286 |
ccctcaccccacttttgtgatgatttgcatacgtgacacat |
326 |
Q |
| |
|
|||| |||||||||||||||||||||||| ||||| ||||| |
|
|
| T |
17070646 |
ccctgaccccacttttgtgatgatttgcacacgtggcacat |
17070686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #189
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 21050575 - 21050627
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||| ||||||||||| ||||||||| ||| |||| ||||||||| |
|
|
| T |
21050575 |
ggctaaaatatgattttagtccctacaaatatgcttcgttttgattttagtcc |
21050627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #190
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 278 - 314
Target Start/End: Complemental strand, 26133311 - 26133275
Alignment:
| Q |
278 |
aaaatagtccctcaccccacttttgtgatgatttgca |
314 |
Q |
| |
|
|||||||||||| |||||| ||||||||||||||||| |
|
|
| T |
26133311 |
aaaatagtccctaaccccatttttgtgatgatttgca |
26133275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #191
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 36973710 - 36973658
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| ||||||| ||||||| |||| |||| ||||||||| |
|
|
| T |
36973710 |
ggctaaaatatggttttggtccctggaaatatgtctcgttttgattttagtcc |
36973658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #192
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 38555083 - 38555032
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||||||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
38555083 |
ggctaaaatatggtttg-gtccctgcaaatatgcctcattttggttttagtcc |
38555032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #193
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 173 - 221
Target Start/End: Original strand, 40038494 - 40038542
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggtttta |
221 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||||||| |||| ||||| |
|
|
| T |
40038494 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttgatttta |
40038542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #194
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 173 - 221
Target Start/End: Complemental strand, 40038858 - 40038810
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggtttta |
221 |
Q |
| |
|
||||| |||||| |||| |||||||||||||||||| | |||||||||| |
|
|
| T |
40038858 |
ggctaaaatatgattttggtccctgcaaatatgccttgttttggtttta |
40038810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 67; Significance: 1e-29; HSPs: 211)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 277 - 347
Target Start/End: Complemental strand, 1559605 - 1559535
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttata |
347 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1559605 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttata |
1559535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 179 - 344
Target Start/End: Original strand, 30709331 - 30709492
Alignment:
| Q |
179 |
aatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgtnnnnnnnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnnnnga |
278 |
Q |
| |
|
|||||| ||||||||||| ||||||||||||| |||||||||||||||||| ||||||||||||||||||||| || |
|
|
| T |
30709331 |
aatatgattttagtccctacaaatatgcctcgttttggttttagtccttgtaaaaaaaaaa----ttgtttttggtccctgcaaaattttttgtttttga |
30709426 |
T |
 |
| Q |
279 |
aaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30709427 |
aaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
30709492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 66; E-Value: 6e-29
Query Start/End: Original strand, 173 - 344
Target Start/End: Original strand, 7431951 - 7432120
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgtnnnnnnnnnnnnnnttgtttttggtccctgcaaaannnnnnnn |
272 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| ||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
7431951 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtctttg--gtaaaaaaaaaaattgtttttggtccctgcaaaattttttgt |
7432048 |
T |
 |
| Q |
273 |
nnnngaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
7432049 |
ttttgaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaatttt |
7432120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 173 - 344
Target Start/End: Original strand, 28911577 - 28911746
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgtnnnnnnnnnnnnnnttgtttttggtccctgcaaaannnnnnnn |
272 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| ||| |||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
28911577 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttagttttagtccctgtaaaaaaaaaaaa--ttgtttttggtccctgcaaaattttttgt |
28911674 |
T |
 |
| Q |
273 |
nnnngaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
28911675 |
ttttgaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacccatttt |
28911746 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 173 - 344
Target Start/End: Complemental strand, 37372904 - 37372737
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgtnnnnnnnnnnnnnnttgtttttggtccctgcaaaannnnnnnn |
272 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |||||||||||| | ||| ||||||||||||||||||||| |
|
|
| T |
37372904 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtacctgtaaaaaaaaaa----ttgtttttggtccctgcaaaattttttgt |
37372809 |
T |
 |
| Q |
273 |
nnnngaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
37372808 |
ttttgaaaatagtccctgaccccacttttgtgatgatttgcatacgtgatacattataactgaaccaatttt |
37372737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 173 - 344
Target Start/End: Complemental strand, 1007229 - 1007061
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgtnnnnnnnnnnnnnnttgtttttggtccctgcaaaannnnnnnn |
272 |
Q |
| |
|
||||| |||||||||||||||||| ||||||||||||| |||| |||||||||||| ||||||||||||||||||||| |
|
|
| T |
1007229 |
ggctaaaatatggttttagtccctccaaatatgcctcgttttgattttagtccttg---gtaaaaaaaaaattgtttttggtccctgcaaaattttttgt |
1007133 |
T |
 |
| Q |
273 |
nnnngaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
1007132 |
ttttgaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaatttt |
1007061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 61; E-Value: 6e-26
Query Start/End: Original strand, 173 - 344
Target Start/End: Complemental strand, 17999721 - 17999556
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgtnnnnnnnnnnnnnnttgtttttggtccctgcaaaannnnnnnn |
272 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
17999721 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaa------ttgtttttggtccctgcaaaattttttgt |
17999628 |
T |
 |
| Q |
273 |
nnnngaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||||| ||||||| |||||||| ||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
17999627 |
ttttgaaaatagtccctgaccccacgtttgtgataatttgcatacgtggcacattataactgaaccaatttt |
17999556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 61; E-Value: 6e-26
Query Start/End: Original strand, 173 - 348
Target Start/End: Complemental strand, 44344789 - 44344619
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgtnnnnnnnnnnnnnnttgtttttggtccctgcaaaannnnnnnn |
272 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |||| |||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
44344789 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaa-----ttgtttttggtccctgcaaaaatttttgt |
44344695 |
T |
 |
| Q |
273 |
nnnngaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttatag |
348 |
Q |
| |
|
|||||||||| || ||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||| |
|
|
| T |
44344694 |
ttttgaaaatagtcactgaccccacttttgtgatgattttcatacgtggcacattataactgaaccaattttatag |
44344619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 61; E-Value: 6e-26
Query Start/End: Original strand, 173 - 344
Target Start/End: Complemental strand, 45073641 - 45073474
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgtnnnnnnnnnnnnnnttgtttttggtccctgcaaaannnnnnnn |
272 |
Q |
| |
|
||||| ||||| |||||||||||||||||||||||||| |||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
45073641 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaaa----ttgtttttggtccctgcaaaaatttttgt |
45073546 |
T |
 |
| Q |
273 |
nnnngaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
|||||||||| || |||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
45073545 |
ttttgaaaatagtctctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaatttt |
45073474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 277 - 344
Target Start/End: Original strand, 488814 - 488881
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
|||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
488814 |
gaaaatagtctctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
488881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 277 - 344
Target Start/End: Complemental strand, 5308586 - 5308519
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
|||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5308586 |
gaaaatagtctctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
5308519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 277 - 344
Target Start/End: Complemental strand, 6108596 - 6108529
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
6108596 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaatttt |
6108529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 277 - 344
Target Start/End: Original strand, 39719455 - 39719522
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
39719455 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaatttt |
39719522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 277 - 344
Target Start/End: Original strand, 45021597 - 45021664
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
45021597 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaatttt |
45021664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 173 - 344
Target Start/End: Complemental strand, 35015220 - 35015051
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgtnnnnnnnnnnnnnnttgtttttggtccctgcaaaannnnnnnn |
272 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |||| ||||||||| || ||||||||||||||||||||| |
|
|
| T |
35015220 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctg--gtaaaaaaaatttttgtttttggtccctgcaaaattttttgt |
35015123 |
T |
 |
| Q |
273 |
nnnngaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||| ||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
35015122 |
ttttgaaaatagttcctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaatttt |
35015051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 173 - 344
Target Start/End: Original strand, 19783815 - 19783983
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgtnnnnnnnnnnnnnnttgtttttggtccctgcaaaannnnnnnn |
272 |
Q |
| |
|
||||| ||||| ||||||||||||||||||||| |||| |||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
19783815 |
ggctaaaatatagttttagtccctgcaaatatgtctcgttttggttttagtccttgtaaaaaaaaaat---ttgtttttggtccctgcaaatttttttgt |
19783911 |
T |
 |
| Q |
273 |
nnnngaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||||| | |||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
19783912 |
ttttgaaaatagtccctgatcccacttttgtgatgatttgcatacgtggcacattataactgaaccaatttt |
19783983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 277 - 344
Target Start/End: Complemental strand, 12894301 - 12894234
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||| | |||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
12894301 |
gaaaatagtccatgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaatttt |
12894234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 277 - 344
Target Start/End: Original strand, 14738700 - 14738767
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
|||||||||| || |||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
14738700 |
gaaaatagtctctaaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaatttt |
14738767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 277 - 344
Target Start/End: Original strand, 21223508 - 21223575
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
|||||||||| || |||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
21223508 |
gaaaatagtctctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaatttt |
21223575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 277 - 340
Target Start/End: Original strand, 22871162 - 22871225
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
340 |
Q |
| |
|
|||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22871162 |
gaaaatagaccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
22871225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #21
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 277 - 344
Target Start/End: Complemental strand, 31732350 - 31732283
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||||| |||||| ||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
31732350 |
gaaaatagtccctgaccccatttttgtgatgatttgcatacgtggcacattataactgaaccaatttt |
31732283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #22
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 277 - 344
Target Start/End: Complemental strand, 46304281 - 46304214
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
|||||||||| || |||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
46304281 |
gaaaatagtctctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaatttt |
46304214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #23
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 277 - 343
Target Start/End: Original strand, 39833005 - 39833071
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattt |
343 |
Q |
| |
|
||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
39833005 |
gaaaatagttcctgaccccacttttgtgatgatttgcatacgtgacacattataactaaaccaattt |
39833071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #24
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 278 - 344
Target Start/End: Complemental strand, 48358975 - 48358909
Alignment:
| Q |
278 |
aaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||| || |||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
48358975 |
aaaatagtctctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaatttt |
48358909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #25
Raw Score: 54; E-Value: 8e-22
Query Start/End: Original strand, 277 - 342
Target Start/End: Complemental strand, 25547390 - 25547325
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatt |
342 |
Q |
| |
|
|||||||||| || |||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25547390 |
gaaaatagtctctgaccccatttttgtgatgatttgcatacgtgacacattataactgaaccaatt |
25547325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #26
Raw Score: 54; E-Value: 8e-22
Query Start/End: Original strand, 173 - 344
Target Start/End: Original strand, 44508720 - 44508887
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgtnnnnnnnnnnnnnnttgtttttggtccctgcaaaannnnnnnn |
272 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |||||||||||||| || ||||||||||||||||||||| |
|
|
| T |
44508720 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg----gtaaaaaaaatttgtttttggtccctgcaaaaatttttgt |
44508815 |
T |
 |
| Q |
273 |
nnnngaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
|||||||||| || ||||||||||||| |||||||||||||||| |||||||||| |||||||||||| |
|
|
| T |
44508816 |
ttttgaaaatagtctctgaccccacttttgttatgatttgcatacgtggcacattataagtgaaccaatttt |
44508887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #27
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 173 - 344
Target Start/End: Complemental strand, 21554753 - 21554585
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgtnnnnnnnnnnnnnnttgtttttggtccctgcaaaannnnnnnn |
272 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||| | |||| ||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
21554753 |
ggctaaaatatggttttagtccctgcaaatatgccttgttttgattttagtccctgtaaaaaaaaaaa---ttgtttttggtccctgcaaaattttttgt |
21554657 |
T |
 |
| Q |
273 |
nnnngaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||||| ||||||||||||||||| |||||||| ||| ||||||||||||||||||||||| |
|
|
| T |
21554656 |
ttttgaaaatagtccctgaccccacttttgtgatgttttgcatatgtggcacattataactgaaccaatttt |
21554585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #28
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 277 - 344
Target Start/End: Original strand, 19561249 - 19561316
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||||| || ||||||||||||||||||||||| ||| ||||||||||||||||||||||| |
|
|
| T |
19561249 |
gaaaatagtccctgacaccacttttgtgatgatttgcatatgtggcacattataactgaaccaatttt |
19561316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #29
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 277 - 344
Target Start/End: Original strand, 30352662 - 30352729
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||||| || ||| ||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
30352662 |
gaaaatagtccctgactccatttttgtgatgatttgcatacgtggcacattataactgaaccaatttt |
30352729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #30
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 277 - 344
Target Start/End: Complemental strand, 44403151 - 44403084
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
|||||||||| || |||||||||||||||||||||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
44403151 |
gaaaatagtctctgaccccacttttgtgatgatttgcatacgtggcacgttataactgaaccaatttt |
44403084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #31
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 278 - 344
Target Start/End: Original strand, 18022468 - 18022534
Alignment:
| Q |
278 |
aaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
|||||| ||||| |||||||||||||||| ||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
18022468 |
aaaataatccctgaccccacttttgtgattatttgcatacgtggcacattataactgaaccaatttt |
18022534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #32
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 278 - 344
Target Start/End: Original strand, 18311682 - 18311748
Alignment:
| Q |
278 |
aaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||| || |||||||||||||||||||||||||||||| |||||||||| |||||||||||| |
|
|
| T |
18311682 |
aaaatagtctctgaccccacttttgtgatgatttgcatacgtggcacattataattgaaccaatttt |
18311748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #33
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 173 - 344
Target Start/End: Complemental strand, 35210515 - 35210344
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgtnnnnnnnnnnnnnnttgtttttggtccctgcaaaannnnnnnn |
272 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |||| |||||||||||||| ||| |||||| |||||| ||||||| |
|
|
| T |
35210515 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaataaaattgtttctggtccttgcaaaattttttgt |
35210416 |
T |
 |
| Q |
273 |
nnnngaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||| | ||||||||||||||||||| |||||||||| ||||||||||||||| ||||||| |
|
|
| T |
35210415 |
ttttgaaaatagtccttaaccccacttttgtgatgatgtgcatacgtggcacattataactgaatcaatttt |
35210344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #34
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 278 - 344
Target Start/End: Original strand, 10358105 - 10358171
Alignment:
| Q |
278 |
aaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
|||||||||||| |||||| ||||||||||||||||||||||| ||||| || |||||||||||||| |
|
|
| T |
10358105 |
aaaatagtccctgaccccatttttgtgatgatttgcatacgtggcacatgatgactgaaccaatttt |
10358171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #35
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 1006835 - 1006887
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
1006835 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
1006887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #36
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 6108334 - 6108386
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
6108334 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
6108386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #37
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 12894402 - 12894350
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
12894402 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
12894350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #38
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 173 - 229
Target Start/End: Original strand, 13769774 - 13769830
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgt |
229 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |||| |||||||||||||||||| |
|
|
| T |
13769774 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccttgt |
13769830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #39
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 173 - 229
Target Start/End: Complemental strand, 18022704 - 18022648
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgt |
229 |
Q |
| |
|
||||| |||||| ||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
18022704 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccttgt |
18022648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #40
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 19757748 - 19757800
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
19757748 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
19757800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #41
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 28911906 - 28911854
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
28911906 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
28911854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #42
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 44509054 - 44509002
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
44509054 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
44509002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #43
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 173 - 223
Target Start/End: Original strand, 19561154 - 19561204
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagt |
223 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
19561154 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
19561204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #44
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 278 - 336
Target Start/End: Complemental strand, 31310577 - 31310519
Alignment:
| Q |
278 |
aaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaa |
336 |
Q |
| |
|
|||||||||||| |||||| ||||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
31310577 |
aaaatagtccctgaccccatttttgtgatgatttgcatacgtggcacattatgactgaa |
31310519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #45
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 295 - 344
Target Start/End: Complemental strand, 1974207 - 1974158
Alignment:
| Q |
295 |
cacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
|||| |||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
1974207 |
cactattgtgatgatttgcatacgtgacaaattataactgaaccaatttt |
1974158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #46
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 173 - 226
Target Start/End: Complemental strand, 3975838 - 3975785
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcct |
226 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||||||| ||||||||||||||| |
|
|
| T |
3975838 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcct |
3975785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #47
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 180 - 225
Target Start/End: Original strand, 16940769 - 16940814
Alignment:
| Q |
180 |
atatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
16940769 |
atatggttttggtccctgcaaatatgcctcggtttggttttagtcc |
16940814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #48
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 284 - 337
Target Start/End: Original strand, 35665984 - 35666037
Alignment:
| Q |
284 |
gtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaac |
337 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||| || ||||||| |
|
|
| T |
35665984 |
gtccctgaccccacttttgtgatgatttgcatacgtgacacatgatgactgaac |
35666037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #49
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 1614904 - 1614852
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
1614904 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
1614852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #50
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 3975549 - 3975601
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
3975549 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
3975601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #51
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 6509208 - 6509260
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| ||| |||||||||| |
|
|
| T |
6509208 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttcgttttagtcc |
6509260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #52
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 6509470 - 6509418
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||||||||||||||| ||||||||||||| |||||||||||||| |
|
|
| T |
6509470 |
ggctaaaatatggttttagtccctacaaatatgcctcgttttggttttagtcc |
6509418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #53
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 8144658 - 8144606
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
8144658 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
8144606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #54
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 221
Target Start/End: Complemental strand, 8555799 - 8555751
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggtttta |
221 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
8555799 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
8555751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #55
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 9659689 - 9659637
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
9659689 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
9659637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #56
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 10358368 - 10358316
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
10358368 |
ggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtcc |
10358316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #57
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 16853589 - 16853537
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
16853589 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
16853537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #58
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 17999465 - 17999517
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| ||||||||| |||| |
|
|
| T |
17999465 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttcgtcc |
17999517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #59
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 19561450 - 19561398
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |||| |||||||||||||| |
|
|
| T |
19561450 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
19561398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #60
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 20388274 - 20388326
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||| | |||||||||||||| |
|
|
| T |
20388274 |
ggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtcc |
20388326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #61
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 21223748 - 21223696
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||||||||||||||||||||||| ||||| |||||||||||||| |
|
|
| T |
21223748 |
ggctaaaatatggttttagtccctgcaaatatacctcgttttggttttagtcc |
21223696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #62
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 229
Target Start/End: Original strand, 21554393 - 21554449
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgt |
229 |
Q |
| |
|
||||| |||||| |||||||||||| |||||||||||| |||||||||||||||||| |
|
|
| T |
21554393 |
ggctaaaatatgattttagtccctgaaaatatgcctcgttttggttttagtccttgt |
21554449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #63
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 23399612 - 23399664
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
23399612 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
23399664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #64
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 23676452 - 23676400
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
23676452 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
23676400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #65
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 25988749 - 25988697
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
25988749 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
25988697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #66
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 26878071 - 26878019
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
26878071 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
26878019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #67
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 29198662 - 29198610
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
29198662 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
29198610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #68
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 229
Target Start/End: Complemental strand, 30223795 - 30223739
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgt |
229 |
Q |
| |
|
||||| ||||||||||| |||| ||||||||||||||| |||||||||||||||||| |
|
|
| T |
30223795 |
ggctaaaatatggttttggtccatgcaaatatgcctcgttttggttttagtccttgt |
30223739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #69
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 229
Target Start/End: Original strand, 35837924 - 35837980
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgt |
229 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||| |||| |||||||||||||||||| |
|
|
| T |
35837924 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccttgt |
35837980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #70
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 39832906 - 39832958
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |||| |||||||||||||| |
|
|
| T |
39832906 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
39832958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #71
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 39833236 - 39833184
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||||||||||| ||||||||||||||||| |||||||||||||| |
|
|
| T |
39833236 |
ggctaaaatatggttttagttcctgcaaatatgcctcgttttggttttagtcc |
39833184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #72
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 45228918 - 45228866
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
45228918 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
45228866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #73
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 229
Target Start/End: Complemental strand, 46648715 - 46648659
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgt |
229 |
Q |
| |
|
||||| ||||||||||||||| |||||||||||||||| |||||||||| ||||||| |
|
|
| T |
46648715 |
ggctaaaatatggttttagtctctgcaaatatgcctcgttttggttttaatccttgt |
46648659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #74
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 229
Target Start/End: Original strand, 46759658 - 46759714
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgt |
229 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||| |||| |||||||||||||||||| |
|
|
| T |
46759658 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccttgt |
46759714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #75
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 48192488 - 48192436
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
48192488 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
48192436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #76
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 229
Target Start/End: Complemental strand, 48359075 - 48359019
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgt |
229 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |||| |||||||||||| ||||| |
|
|
| T |
48359075 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcttgt |
48359019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #77
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 229
Target Start/End: Original strand, 48852444 - 48852500
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgt |
229 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
48852444 |
ggctaaaatatggttttggtccctgcaaatatgcctcgtttttgttttagtccttgt |
48852500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #78
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 174 - 225
Target Start/End: Original strand, 6079810 - 6079861
Alignment:
| Q |
174 |
gctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||| |||| ||||||||| |
|
|
| T |
6079810 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtcc |
6079861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #79
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 173 - 228
Target Start/End: Original strand, 6589021 - 6589076
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttg |
228 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||||||| ||||||||| ||||||| |
|
|
| T |
6589021 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttggtccttg |
6589076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #80
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 277 - 344
Target Start/End: Original strand, 19757851 - 19757918
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
|||||||||| || |||||| ||||||||||||||||||||||| ||||| || |||||||| ||||| |
|
|
| T |
19757851 |
gaaaatagtcactgaccccatttttgtgatgatttgcatacgtggcacatgatgactgaacccatttt |
19757918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #81
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 173 - 224
Target Start/End: Original strand, 23816670 - 23816721
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtc |
224 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |||| ||||||||||||| |
|
|
| T |
23816670 |
ggctaaaatatggttttagtccctgcaaatatggctcgttttggttttagtc |
23816721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #82
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 173 - 223
Target Start/End: Complemental strand, 13770081 - 13770031
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagt |
223 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||| || |||||||||||| |
|
|
| T |
13770081 |
ggctaaaatatggttttagtccctgcaaatatgccccgttttggttttagt |
13770031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #83
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 179 - 225
Target Start/End: Original strand, 30352566 - 30352612
Alignment:
| Q |
179 |
aatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
30352566 |
aatatggttttagtccctgcaaatatgcctcgttttggtttcagtcc |
30352612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #84
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 179 - 225
Target Start/End: Complemental strand, 32189384 - 32189338
Alignment:
| Q |
179 |
aatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||||||||||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
32189384 |
aatatggttttagtctctgcaaatatgcctcgttttggttttagtcc |
32189338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #85
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 179 - 225
Target Start/End: Complemental strand, 35104289 - 35104243
Alignment:
| Q |
179 |
aatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
35104289 |
aatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
35104243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #86
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 179 - 225
Target Start/End: Original strand, 37372443 - 37372489
Alignment:
| Q |
179 |
aatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||||||||||||||||||||||||| |||| |||||||||||||| |
|
|
| T |
37372443 |
aatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
37372489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #87
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 173 - 223
Target Start/End: Complemental strand, 45021856 - 45021806
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagt |
223 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
45021856 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagt |
45021806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #88
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 173 - 227
Target Start/End: Original strand, 46304086 - 46304140
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcctt |
227 |
Q |
| |
|
||||| |||||| ||||||| ||||||||||||||||| |||||||||||||||| |
|
|
| T |
46304086 |
ggctaaaatatgattttagttcctgcaaatatgcctcgttttggttttagtcctt |
46304140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #89
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 179 - 225
Target Start/End: Original strand, 48192263 - 48192309
Alignment:
| Q |
179 |
aatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
48192263 |
aatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
48192309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #90
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 45021494 - 45021547
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggttt-ggttttagtcc |
225 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
45021494 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttgggttttagtcc |
45021547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #91
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 229
Target Start/End: Complemental strand, 1559705 - 1559649
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgt |
229 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| ||| ||||||||| ||| |
|
|
| T |
1559705 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttaattttagtccctgt |
1559649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #92
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 1614559 - 1614611
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||| |||| |||||||||||||| |
|
|
| T |
1614559 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
1614611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #93
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 1974009 - 1974061
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
1974009 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttagtcc |
1974061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #94
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 5233808 - 5233860
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||| ||| |||||||||||||| |
|
|
| T |
5233808 |
ggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtcc |
5233860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #95
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 5354768 - 5354820
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| ||||||| |||||||||||| |||||||||||||| |
|
|
| T |
5354768 |
ggctaaaatatggttttggtccctgtaaatatgcctcgttttggttttagtcc |
5354820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #96
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 181 - 229
Target Start/End: Complemental strand, 5355109 - 5355061
Alignment:
| Q |
181 |
tatggttttagtccctgcaaatatgcctcggtttggttttagtccttgt |
229 |
Q |
| |
|
||||||||| |||||||||||||||||||| ||||||||||||| |||| |
|
|
| T |
5355109 |
tatggttttggtccctgcaaatatgcctcgttttggttttagtcattgt |
5355061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #97
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 8144295 - 8144347
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||| |||| |||||||||||||| |
|
|
| T |
8144295 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
8144347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #98
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 10358001 - 10358053
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||| | ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
10358001 |
ggctaaaatatgatcttagtccctgcaaatatgcctcgttttggttttagtcc |
10358053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #99
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 14739004 - 14738952
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| ||| |||| ||||||||| |
|
|
| T |
14739004 |
ggctaaaatatggttttagtccctgcaaatatgcttcgttttgattttagtcc |
14738952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #100
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 23399976 - 23399924
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||| |||| |||||||||||||| |
|
|
| T |
23399976 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
23399924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #101
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 25092160 - 25092212
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||| |||| |||||||||||||| |
|
|
| T |
25092160 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
25092212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #102
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 25092548 - 25092496
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
25092548 |
ggctaaaatatggttttggtccctgcaaatatgcctctttttggttttagtcc |
25092496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #103
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 179 - 223
Target Start/End: Original strand, 25547259 - 25547303
Alignment:
| Q |
179 |
aatatggttttagtccctgcaaatatgcctcggtttggttttagt |
223 |
Q |
| |
|
|||||||||||| ||||||||||||||||||| |||||||||||| |
|
|
| T |
25547259 |
aatatggttttaatccctgcaaatatgcctcgttttggttttagt |
25547303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #104
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 229
Target Start/End: Complemental strand, 25547490 - 25547434
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgt |
229 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |||| |||| ||||||||| ||| |
|
|
| T |
25547490 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctgt |
25547434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #105
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 25988385 - 25988437
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||| |||| |||||||||||||| |
|
|
| T |
25988385 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
25988437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #106
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 27037593 - 27037645
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||||||| ||| |||||||||| |
|
|
| T |
27037593 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttagttttagtcc |
27037645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #107
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 27458399 - 27458451
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||| |||| |||||||||||||| |
|
|
| T |
27458399 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
27458451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #108
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 30352904 - 30352852
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||| |||||||||||||||||||||||||| |||| ||||||||| |
|
|
| T |
30352904 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttgattttagtcc |
30352852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #109
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 221
Target Start/End: Original strand, 31732101 - 31732149
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggtttta |
221 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |||| ||||| |
|
|
| T |
31732101 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttgatttta |
31732149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #110
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 229
Target Start/End: Complemental strand, 31732451 - 31732395
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgt |
229 |
Q |
| |
|
||||| |||||||||||||||| ||||||||||||||| |||| |||||| |||||| |
|
|
| T |
31732451 |
ggctaaaatatggttttagtccatgcaaatatgcctcgttttgattttagcccttgt |
31732395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #111
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 35665877 - 35665929
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||||||||| ||||| ||||||||||||| |||||||||||||| |
|
|
| T |
35665877 |
ggctaaaatatggttttaatccctacaaatatgcctcgttttggttttagtcc |
35665929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #112
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 35838337 - 35838285
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||| |||| |||||||||||||| |
|
|
| T |
35838337 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
35838285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #113
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 39719642 - 39719590
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |||| ||| |||||||||| |
|
|
| T |
39719642 |
ggctaaaatatggttttagtccctgcaaatatggctcgttttagttttagtcc |
39719590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #114
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 41054236 - 41054184
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
41054236 |
ggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtcc |
41054184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #115
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 174 - 226
Target Start/End: Original strand, 43300613 - 43300665
Alignment:
| Q |
174 |
gctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcct |
226 |
Q |
| |
|
|||| |||||||||||||| |||||||||||| |||| ||||||||||||||| |
|
|
| T |
43300613 |
gctaaaatatggttttagttcctgcaaatatgtctcgttttggttttagtcct |
43300665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #116
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 44402960 - 44403012
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||| | |||||||||||||| |
|
|
| T |
44402960 |
ggctaaaatatggttttagtccctgcaaatatgccccattttggttttagtcc |
44403012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #117
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 44403249 - 44403197
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||||||||||||| |||||||||| |||| |||||||||||||| |
|
|
| T |
44403249 |
ggctaaaatatggttttagtccttgcaaatatgtctcgttttggttttagtcc |
44403197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #118
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 221
Target Start/End: Original strand, 45073314 - 45073362
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggtttta |
221 |
Q |
| |
|
||||| ||||||||||||||||||||||||| |||||| |||||||||| |
|
|
| T |
45073314 |
ggctaaaatatggttttagtccctgcaaataagcctcgttttggtttta |
45073362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #119
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 182 - 225
Target Start/End: Complemental strand, 1271590 - 1271547
Alignment:
| Q |
182 |
atggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
|||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
1271590 |
atggttttggtccctgcaaatatgcctcgttttggttttagtcc |
1271547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #120
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 173 - 224
Target Start/End: Original strand, 21223405 - 21223456
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtc |
224 |
Q |
| |
|
||||| |||||| ||||||||||||||||||||| ||| ||||||||||||| |
|
|
| T |
21223405 |
ggctaaaatatgattttagtccctgcaaatatgcttcgttttggttttagtc |
21223456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #121
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 173 - 224
Target Start/End: Complemental strand, 30709644 - 30709593
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtc |
224 |
Q |
| |
|
||||| |||||| |||||||||||||||||||| |||| ||||||||||||| |
|
|
| T |
30709644 |
ggctaaaatatgattttagtccctgcaaatatgtctcgttttggttttagtc |
30709593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #122
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 173 - 224
Target Start/End: Original strand, 39438741 - 39438792
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtc |
224 |
Q |
| |
|
||||| ||||||||||| ||||||| |||||||||||| ||||||||||||| |
|
|
| T |
39438741 |
ggctaaaatatggttttggtccctgtaaatatgcctcgttttggttttagtc |
39438792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #123
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 173 - 224
Target Start/End: Original strand, 39719353 - 39719404
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtc |
224 |
Q |
| |
|
||||| |||||||||||||||||| |||||||||||| ||||||||||||| |
|
|
| T |
39719353 |
ggctaaaatatggttttagtccctacaaatatgcctcattttggttttagtc |
39719404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #124
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 278 - 337
Target Start/End: Original strand, 45671314 - 45671373
Alignment:
| Q |
278 |
aaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaac |
337 |
Q |
| |
|
|||||| ||||| ||| || ||||||||||||||||||||||||||||| || ||||||| |
|
|
| T |
45671314 |
aaaataatccctgacctcatttttgtgatgatttgcatacgtgacacatgatgactgaac |
45671373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #125
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 284 - 343
Target Start/End: Complemental strand, 46759864 - 46759805
Alignment:
| Q |
284 |
gtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattt |
343 |
Q |
| |
|
|||||| || ||||||||||||||||||||| ||||||||||| || |||||||| |||| |
|
|
| T |
46759864 |
gtccctgactccacttttgtgatgatttgcacacgtgacacatgatgactgaacccattt |
46759805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #126
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 179 - 225
Target Start/End: Complemental strand, 6589268 - 6589222
Alignment:
| Q |
179 |
aatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||||||||| |||||||||||||||||| | |||||||||||||| |
|
|
| T |
6589268 |
aatatggttttggtccctgcaaatatgccttgttttggttttagtcc |
6589222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #127
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 179 - 225
Target Start/End: Original strand, 11766923 - 11766969
Alignment:
| Q |
179 |
aatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||||||||| |||||||||||||||||||| ||||||||| |||| |
|
|
| T |
11766923 |
aatatggttttggtccctgcaaatatgcctcgttttggttttcgtcc |
11766969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #128
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 179 - 225
Target Start/End: Complemental strand, 16941046 - 16941000
Alignment:
| Q |
179 |
aatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||||||||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
16941046 |
aatatggttttggtccctgcaaatatgcctcattttggttttagtcc |
16941000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #129
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 179 - 225
Target Start/End: Original strand, 17854155 - 17854201
Alignment:
| Q |
179 |
aatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||||||||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
17854155 |
aatatggttttagtccctgcaaatatgtctcattttggttttagtcc |
17854201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #130
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 278 - 344
Target Start/End: Original strand, 20388376 - 20388442
Alignment:
| Q |
278 |
aaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
|||||||| ||| |||||| ||||||||||||||||||||||| || || || |||||||| ||||| |
|
|
| T |
20388376 |
aaaatagttcctgaccccatttttgtgatgatttgcatacgtggcatatgatgactgaaccgatttt |
20388442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #131
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 179 - 225
Target Start/End: Original strand, 23676138 - 23676184
Alignment:
| Q |
179 |
aatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||||||||| ||||||||||||||| |||| |||||||||||||| |
|
|
| T |
23676138 |
aatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
23676184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #132
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 173 - 219
Target Start/End: Complemental strand, 31310679 - 31310633
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttt |
219 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| ||| |||||||| |
|
|
| T |
31310679 |
ggctaaaatatggttttagtccctgcaaatatgcatcgttttggttt |
31310633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #133
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 440 - 489
Target Start/End: Original strand, 362705 - 362754
Alignment:
| Q |
440 |
caacaaacctaatcagtatcactgtctaaaataaaccgaacatagatatt |
489 |
Q |
| |
|
||||||||||||||| ||| ||||| |||||||||| ||||||||||||| |
|
|
| T |
362705 |
caacaaacctaatcactattactgtataaaataaactgaacatagatatt |
362754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #134
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 294 - 343
Target Start/End: Original strand, 6589080 - 6589129
Alignment:
| Q |
294 |
ccacttttgtgatgatttgcatacgtgacacattataactgaaccaattt |
343 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| || |||||||| |||| |
|
|
| T |
6589080 |
ccacttttgtgatgatttgcacacgtgacacatgatgactgaacccattt |
6589129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #135
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 179 - 224
Target Start/End: Complemental strand, 6847113 - 6847068
Alignment:
| Q |
179 |
aatatggttttagtccctgcaaatatgcctcggtttggttttagtc |
224 |
Q |
| |
|
||||||||||| |||||||||||||||| ||| ||||||||||||| |
|
|
| T |
6847113 |
aatatggttttggtccctgcaaatatgcttcgttttggttttagtc |
6847068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #136
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 174 - 223
Target Start/End: Original strand, 18022368 - 18022417
Alignment:
| Q |
174 |
gctagaatatggttttagtccctgcaaatatgcctcggtttggttttagt |
223 |
Q |
| |
|
|||| ||||||||||||||||| ||||||||| |||| |||||||||||| |
|
|
| T |
18022368 |
gctaaaatatggttttagtccccgcaaatatgtctcgttttggttttagt |
18022417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #137
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 291 - 344
Target Start/End: Original strand, 19465733 - 19465786
Alignment:
| Q |
291 |
accccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
|||||| ||||||||||||||||||||||| ||||| || |||||||| ||||| |
|
|
| T |
19465733 |
accccatttttgtgatgatttgcatacgtggcacatgatgactgaaccgatttt |
19465786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #138
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 294 - 343
Target Start/End: Original strand, 27458518 - 27458567
Alignment:
| Q |
294 |
ccacttttgtgatgatttgcatacgtgacacattataactgaaccaattt |
343 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| || |||||||| |||| |
|
|
| T |
27458518 |
ccacttttgtgatgatttgcacacgtgacacatgatgactgaacccattt |
27458567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #139
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 179 - 224
Target Start/End: Complemental strand, 31503777 - 31503732
Alignment:
| Q |
179 |
aatatggttttagtccctgcaaatatgcctcggtttggttttagtc |
224 |
Q |
| |
|
||||||||||||||||||||||||||| |||| |||| |||||||| |
|
|
| T |
31503777 |
aatatggttttagtccctgcaaatatgtctcgttttgattttagtc |
31503732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #140
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 295 - 344
Target Start/End: Complemental strand, 38186642 - 38186593
Alignment:
| Q |
295 |
cacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| || |||||||| ||||| |
|
|
| T |
38186642 |
cacttttgtgatgatttgcacacgtgacacatgatgactgaacccatttt |
38186593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #141
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 174 - 223
Target Start/End: Complemental strand, 41365213 - 41365164
Alignment:
| Q |
174 |
gctagaatatggttttagtccctgcaaatatgcctcggtttggttttagt |
223 |
Q |
| |
|
|||| |||||||||||||| || |||||||||||||| |||||||||||| |
|
|
| T |
41365213 |
gctaaaatatggttttagttcccgcaaatatgcctcgttttggttttagt |
41365164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #142
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 173 - 221
Target Start/End: Original strand, 1559343 - 1559391
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggtttta |
221 |
Q |
| |
|
||||| ||||| |||||||||||||||||||||||||| |||| ||||| |
|
|
| T |
1559343 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttgatttta |
1559391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #143
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 2945845 - 2945793
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||| |||| |||||| ||||||||||||| |||||||||||||| |
|
|
| T |
2945845 |
ggctaaaatatgtttttggtccctacaaatatgcctcgttttggttttagtcc |
2945793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #144
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 5234204 - 5234152
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| |||||| |||||||| |||| |||||||||||||| |
|
|
| T |
5234204 |
ggctaaaatatggttttggtccctacaaatatgtctcgttttggttttagtcc |
5234152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #145
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 5308323 - 5308375
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||||||||||||| |||||||||| |||| ||| |||||||||| |
|
|
| T |
5308323 |
ggctaaaatatggttttagtccttgcaaatatgtctcgttttagttttagtcc |
5308375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #146
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 185 - 229
Target Start/End: Complemental strand, 5308675 - 5308631
Alignment:
| Q |
185 |
gttttagtccctgcaaatatgcctcggtttggttttagtccttgt |
229 |
Q |
| |
|
|||||||||||||||||||| ||||| |||||||||||||| ||| |
|
|
| T |
5308675 |
gttttagtccctgcaaatatacctcgttttggttttagtccctgt |
5308631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #147
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 11767275 - 11767223
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||| || |||||||||||||| |
|
|
| T |
11767275 |
ggctaaaatatggttttggtccctgcaaatatgcttcattttggttttagtcc |
11767223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #148
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 12932783 - 12932731
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||| |||| |||||||||||||||||||| |||| ||||||||| |
|
|
| T |
12932783 |
ggctaaaatatgtttttggtccctgcaaatatgcctcgttttgattttagtcc |
12932731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #149
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 14543710 - 14543762
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||| ||| |||||||||||||| |
|
|
| T |
14543710 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtcc |
14543762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #150
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 186 - 226
Target Start/End: Original strand, 14738613 - 14738653
Alignment:
| Q |
186 |
ttttagtccctgcaaatatgcctcggtttggttttagtcct |
226 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
14738613 |
ttttagtccctgcaaatatgcctcattttggttttagtcct |
14738653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #151
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 181 - 225
Target Start/End: Original strand, 24953828 - 24953872
Alignment:
| Q |
181 |
tatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
|||||||||||||||||||||||||| | | |||||||||||||| |
|
|
| T |
24953828 |
tatggttttagtccctgcaaatatgcattgttttggttttagtcc |
24953872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #152
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 173 - 221
Target Start/End: Original strand, 28262713 - 28262761
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggtttta |
221 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||||||| |||||||||| |
|
|
| T |
28262713 |
ggctaaaatatggttttggtccctgcaaatatgcctcattttggtttta |
28262761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #153
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 293 - 337
Target Start/End: Complemental strand, 28262960 - 28262916
Alignment:
| Q |
293 |
cccacttttgtgatgatttgcatacgtgacacattataactgaac |
337 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| || ||||||| |
|
|
| T |
28262960 |
cccacttttgtgatgatttgcacacgtgacacataatgactgaac |
28262916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #154
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 29198303 - 29198355
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| |||||||||||||| |||| |||||||||||||| |
|
|
| T |
29198303 |
ggctaaaatatggttttggtccctgcaaatatatctcgttttggttttagtcc |
29198355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #155
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 30223461 - 30223513
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| ||||| ||||||||| |||| |||||||||||||| |
|
|
| T |
30223461 |
ggctaaaatatggttttggtccccgcaaatatgtctcgttttggttttagtcc |
30223513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #156
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 173 - 221
Target Start/End: Original strand, 32189076 - 32189124
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggtttta |
221 |
Q |
| |
|
||||| |||||| ||||||||||||||||||||| ||| |||||||||| |
|
|
| T |
32189076 |
ggctaaaatatgattttagtccctgcaaatatgcttcgttttggtttta |
32189124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #157
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 39439029 - 39438977
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| ||||||||||||| | |||| |||||||||||||| |
|
|
| T |
39439029 |
ggctaaaatatggttttggtccctgcaaatacgtctcgttttggttttagtcc |
39438977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #158
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 41053842 - 41053894
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||||||| |||| ||||||||| |
|
|
| T |
41053842 |
ggctaaaatatggttttggtccctgcaaatatgcctcattttgattttagtcc |
41053894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #159
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 44568326 - 44568378
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| |||||||||||||| |||| |||||||||||||| |
|
|
| T |
44568326 |
ggctaaaatatggttttggtccctgcaaatataactcgttttggttttagtcc |
44568378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #160
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 44568690 - 44568638
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| |||||||||||||| |||| |||||||||||||| |
|
|
| T |
44568690 |
ggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtcc |
44568638 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #161
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 173 - 229
Target Start/End: Complemental strand, 46304384 - 46304328
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgt |
229 |
Q |
| |
|
||||| ||||| ||||||||||||||||||||| ||| |||||||||||||| ||| |
|
|
| T |
46304384 |
ggctaaaatatagttttagtccctgcaaatatgtttcgttttggttttagtccctgt |
46304328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #162
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 46759942 - 46759890
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||| |||| ||||||||||||||| |||| |||||||||||||| |
|
|
| T |
46759942 |
ggctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagtcc |
46759890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #163
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 46828944 - 46828996
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||| || | |||||||||||||| |
|
|
| T |
46828944 |
ggctaaaatatggttttggtccctgcaaatatgtcttgttttggttttagtcc |
46828996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #164
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 284 - 343
Target Start/End: Original strand, 9659464 - 9659523
Alignment:
| Q |
284 |
gtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattt |
343 |
Q |
| |
|
|||||| || ||||||||||||||||||||| ||||| ||||| || |||||||| |||| |
|
|
| T |
9659464 |
gtccctgactccacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt |
9659523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #165
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 174 - 221
Target Start/End: Original strand, 18311581 - 18311628
Alignment:
| Q |
174 |
gctagaatatggttttagtccctgcaaatatgcctcggtttggtttta |
221 |
Q |
| |
|
|||| ||||||||||||||| || ||||||||||||| |||||||||| |
|
|
| T |
18311581 |
gctaaaatatggttttagtctctacaaatatgcctcgttttggtttta |
18311628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #166
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 173 - 224
Target Start/End: Original strand, 31310365 - 31310416
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtc |
224 |
Q |
| |
|
||||| |||||| ||||||||||||||||||| |||| ||||||||||||| |
|
|
| T |
31310365 |
ggctaaaatatgattttagtccctgcaaatatttctcgttttggttttagtc |
31310416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #167
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 179 - 222
Target Start/End: Original strand, 38186372 - 38186415
Alignment:
| Q |
179 |
aatatggttttagtccctgcaaatatgcctcggtttggttttag |
222 |
Q |
| |
|
||||||||||| |||||||||||||||||||| |||| |||||| |
|
|
| T |
38186372 |
aatatggttttggtccctgcaaatatgcctcgttttgattttag |
38186415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #168
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 284 - 343
Target Start/End: Complemental strand, 46829201 - 46829142
Alignment:
| Q |
284 |
gtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattt |
343 |
Q |
| |
|
|||||| || ||||||||||||||||||||| || |||||||| || | ||||||||||| |
|
|
| T |
46829201 |
gtccctgactccacttttgtgatgatttgcacacatgacacatgatgattgaaccaattt |
46829142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #169
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 179 - 229
Target Start/End: Original strand, 488720 - 488769
Alignment:
| Q |
179 |
aatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgt |
229 |
Q |
| |
|
|||||||||||||||| |||||||||| |||| ||||| |||||||||||| |
|
|
| T |
488720 |
aatatggttttagtccttgcaaatatgtctcgttttgg-tttagtccttgt |
488769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #170
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 278 - 344
Target Start/End: Original strand, 13769874 - 13769939
Alignment:
| Q |
278 |
aaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
|||||||||| | |||| | ||||||||||||||||||||||| ||||| || |||||||| ||||| |
|
|
| T |
13769874 |
aaaatagtcc-tgaccctatttttgtgatgatttgcatacgtggcacatgatgactgaacctatttt |
13769939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #171
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 173 - 223
Target Start/End: Complemental strand, 20388675 - 20388625
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagt |
223 |
Q |
| |
|
||||| ||||||||||||||| ||| |||||||||||| |||| ||||||| |
|
|
| T |
20388675 |
ggctaaaatatggttttagtcgctgaaaatatgcctcgttttgattttagt |
20388625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #172
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 278 - 344
Target Start/End: Complemental strand, 23816933 - 23816867
Alignment:
| Q |
278 |
aaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||| || |||||| ||||||||||||||| ||||||| ||||| || ||| |||| ||||| |
|
|
| T |
23816933 |
aaaatagtctctgaccccatttttgtgatgatttgtatacgtggcacatgatgactaaaccgatttt |
23816867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #173
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 294 - 336
Target Start/End: Complemental strand, 28529150 - 28529108
Alignment:
| Q |
294 |
ccacttttgtgatgatttgcatacgtgacacattataactgaa |
336 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| || |||||| |
|
|
| T |
28529150 |
ccacttttgtgatgatttgcacacgtgacacataatgactgaa |
28529108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #174
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 179 - 225
Target Start/End: Original strand, 34877780 - 34877826
Alignment:
| Q |
179 |
aatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||||||||| ||||||| ||||||| |||| |||||||||||||| |
|
|
| T |
34877780 |
aatatggttttggtccctgtaaatatgtctcgttttggttttagtcc |
34877826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #175
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 292 - 326
Target Start/End: Complemental strand, 37527305 - 37527271
Alignment:
| Q |
292 |
ccccacttttgtgatgatttgcatacgtgacacat |
326 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| |
|
|
| T |
37527305 |
ccccacttttgtgatgatttgcacacgtgacacat |
37527271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #176
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 278 - 348
Target Start/End: Complemental strand, 37952950 - 37952880
Alignment:
| Q |
278 |
aaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttatag |
348 |
Q |
| |
|
|||||||||| | |||||||||||||||| |||||||||||| ||||| || | |||| | ||||||||| |
|
|
| T |
37952950 |
aaaatagtccatgaccccacttttgtgattatttgcatacgtagcacatgatgattgaatccattttatag |
37952880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #177
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 179 - 225
Target Start/End: Original strand, 44841362 - 44841408
Alignment:
| Q |
179 |
aatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||||||||| ||||||||||||||||||| |||| ||||||||| |
|
|
| T |
44841362 |
aatatggttttgatccctgcaaatatgcctcgttttgattttagtcc |
44841408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #178
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 278 - 344
Target Start/End: Original strand, 46648516 - 46648581
Alignment:
| Q |
278 |
aaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
|||||||||| | |||||| |||||||||||||||| |||||| ||||| || |||||||| ||||| |
|
|
| T |
46648516 |
aaaatagtcc-tgaccccatttttgtgatgatttgcgtacgtggcacatgatgactgaacccatttt |
46648581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #179
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 282 - 343
Target Start/End: Complemental strand, 3808072 - 3808011
Alignment:
| Q |
282 |
tagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattt |
343 |
Q |
| |
|
||||| || ||| |||||||||||||||||||| ||||||||||| || || ||||| |||| |
|
|
| T |
3808072 |
tagtctctgacctcacttttgtgatgatttgcacacgtgacacatgatgaccgaacccattt |
3808011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #180
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 294 - 343
Target Start/End: Complemental strand, 5354999 - 5354950
Alignment:
| Q |
294 |
ccacttttgtgatgatttgcatacgtgacacattataactgaaccaattt |
343 |
Q |
| |
|
||||||||||||||||||||| ||||| ||||| || |||||||| |||| |
|
|
| T |
5354999 |
ccacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt |
5354950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #181
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 179 - 224
Target Start/End: Original strand, 6954864 - 6954909
Alignment:
| Q |
179 |
aatatggttttagtccctgcaaatatgcctcggtttggttttagtc |
224 |
Q |
| |
|
||||||||||| |||||||||||||| |||| ||||||||||||| |
|
|
| T |
6954864 |
aatatggttttggtccctgcaaatatatctcgttttggttttagtc |
6954909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #182
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 179 - 224
Target Start/End: Complemental strand, 7432246 - 7432201
Alignment:
| Q |
179 |
aatatggttttagtccctgcaaatatgcctcggtttggttttagtc |
224 |
Q |
| |
|
|||||||||||| | ||||||||||||||||| |||| |||||||| |
|
|
| T |
7432246 |
aatatggttttaattcctgcaaatatgcctcgttttgattttagtc |
7432201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #183
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 294 - 343
Target Start/End: Original strand, 11767036 - 11767085
Alignment:
| Q |
294 |
ccacttttgtgatgatttgcatacgtgacacattataactgaaccaattt |
343 |
Q |
| |
|
||||||||||||||||||||| ||||| ||||| || |||||||| |||| |
|
|
| T |
11767036 |
ccacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt |
11767085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #184
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 188 - 221
Target Start/End: Original strand, 12894056 - 12894089
Alignment:
| Q |
188 |
ttagtccctgcaaatatgcctcggtttggtttta |
221 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| |
|
|
| T |
12894056 |
ttagtccctgcaaatatgcctcgttttggtttta |
12894089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #185
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 279 - 320
Target Start/End: Complemental strand, 17854356 - 17854315
Alignment:
| Q |
279 |
aaatagtccctcaccccacttttgtgatgatttgcatacgtg |
320 |
Q |
| |
|
||||||||||| || ||| ||||||||||||||||||||||| |
|
|
| T |
17854356 |
aaatagtccctgactccatttttgtgatgatttgcatacgtg |
17854315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #186
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 179 - 224
Target Start/End: Complemental strand, 18891559 - 18891514
Alignment:
| Q |
179 |
aatatggttttagtccctgcaaatatgcctcggtttggttttagtc |
224 |
Q |
| |
|
||||||||||||||||||||||||||| |||| ||| |||||||| |
|
|
| T |
18891559 |
aatatggttttagtccctgcaaatatgtctcgttttaattttagtc |
18891514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #187
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 188 - 225
Target Start/End: Complemental strand, 19758044 - 19758007
Alignment:
| Q |
188 |
ttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||| |
|
|
| T |
19758044 |
ttagtccctgcaaatatgcctcattttggttttagtcc |
19758007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #188
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 294 - 343
Target Start/End: Original strand, 30223580 - 30223629
Alignment:
| Q |
294 |
ccacttttgtgatgatttgcatacgtgacacattataactgaaccaattt |
343 |
Q |
| |
|
||||||||||||||||||||| ||||| ||||| || |||||||| |||| |
|
|
| T |
30223580 |
ccacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt |
30223629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #189
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 282 - 343
Target Start/End: Original strand, 35104125 - 35104186
Alignment:
| Q |
282 |
tagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattt |
343 |
Q |
| |
|
|||||||| || ||||||||||||||||||||| ||||| ||||| || ||||||| |||| |
|
|
| T |
35104125 |
tagtccctgactccacttttgtgatgatttgcacacgtggcacatgatggctgaacccattt |
35104186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #190
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 179 - 224
Target Start/End: Complemental strand, 37953045 - 37953000
Alignment:
| Q |
179 |
aatatggttttagtccctgcaaatatgcctcggtttggttttagtc |
224 |
Q |
| |
|
||||||||||||||||||| ||||||| || | ||||||||||||| |
|
|
| T |
37953045 |
aatatggttttagtccctgtaaatatgtcttgttttggttttagtc |
37953000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #191
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 294 - 343
Target Start/End: Original strand, 39520517 - 39520566
Alignment:
| Q |
294 |
ccacttttgtgatgatttgcatacgtgacacattataactgaaccaattt |
343 |
Q |
| |
|
||||||||||||||||||||| ||||| ||||| || |||||||| |||| |
|
|
| T |
39520517 |
ccacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt |
39520566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #192
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 294 - 343
Target Start/End: Original strand, 48852563 - 48852612
Alignment:
| Q |
294 |
ccacttttgtgatgatttgcatacgtgacacattataactgaaccaattt |
343 |
Q |
| |
|
||||||||||||||||||||| | ||||||||| || |||||||| |||| |
|
|
| T |
48852563 |
ccacttttgtgatgatttgcacatgtgacacatgatgactgaacccattt |
48852612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #193
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 489072 - 489020
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||| |||||||| ||||||||||| |||| |||| ||||||||| |
|
|
| T |
489072 |
ggctaaaatatgattttagtctctgcaaatatgtctcgttttgattttagtcc |
489020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #194
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 173 - 221
Target Start/End: Complemental strand, 6911247 - 6911199
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggtttta |
221 |
Q |
| |
|
||||| ||||||||||| || ||||||||||| ||||| |||||||||| |
|
|
| T |
6911247 |
ggctaaaatatggttttggttcctgcaaatatacctcgttttggtttta |
6911199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #195
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 9659355 - 9659407
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| |||||||||||||| |||| |||| ||||||||| |
|
|
| T |
9659355 |
ggctaaaatatggttttgctccctgcaaatatgtctcgttttgattttagtcc |
9659407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #196
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 296 - 336
Target Start/End: Original strand, 14543799 - 14543839
Alignment:
| Q |
296 |
acttttgtgatgatttgcatacgtgacacattataactgaa |
336 |
Q |
| |
|
||||||||||||||||||| ||||||||||| || |||||| |
|
|
| T |
14543799 |
acttttgtgatgatttgcacacgtgacacatgatgactgaa |
14543839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #197
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 173 - 229
Target Start/End: Complemental strand, 18927091 - 18927035
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgt |
229 |
Q |
| |
|
||||| ||||| ||||||||||||||||||||| ||| ||| ||||||||| |||| |
|
|
| T |
18927091 |
ggctaaaatatagttttagtccctgcaaatatgtctcattttagttttagtcattgt |
18927035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #198
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 19465980 - 19465929
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||||| ||||||||||||| |||| || ||||||||||| |
|
|
| T |
19465980 |
ggctaaaatatggttttag-ccctgcaaatatgtctcgtttcggttttagtcc |
19465929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #199
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 24717532 - 24717480
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| |||||| | |||||| |||| |||||||||||||| |
|
|
| T |
24717532 |
ggctaaaatatggttttggtccctaccaatatgtctcgttttggttttagtcc |
24717480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #200
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 26877678 - 26877730
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| || ||||||||||| |||| |||||||||||||| |
|
|
| T |
26877678 |
ggctaaaatatggttttgatctctgcaaatatgtctcgttttggttttagtcc |
26877730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #201
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 173 - 221
Target Start/End: Complemental strand, 34878125 - 34878077
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggtttta |
221 |
Q |
| |
|
||||| ||||||||||| |||||||||||||| |||| |||||||||| |
|
|
| T |
34878125 |
ggctaaaatatggttttgatccctgcaaatatgtctcgttttggtttta |
34878077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #202
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 35104078 - 35104130
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||| |||| ||||||||||||||| |||| |||||||||||||| |
|
|
| T |
35104078 |
ggctaaaatataattttggtccctgcaaatatgtctcgttttggttttagtcc |
35104130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #203
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 35470280 - 35470228
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||| ||||||| |||||||||||||||||| |||||||||||||| |
|
|
| T |
35470280 |
ggctaaaatttggttttgatccctgcaaatatgcctcattttggttttagtcc |
35470228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #204
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 39520398 - 39520450
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| |||| | |||||||| |||| |||||||||||||| |
|
|
| T |
39520398 |
ggctaaaatatggttttggtccatccaaatatgtctcgttttggttttagtcc |
39520450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #205
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 41364884 - 41364936
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||||||||| || || |||||||| |||| |||||||||||||| |
|
|
| T |
41364884 |
ggctaaaatatggttttaatctctacaaatatgtctcgttttggttttagtcc |
41364936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #206
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 173 - 229
Target Start/End: Original strand, 44344457 - 44344513
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgt |
229 |
Q |
| |
|
||||| |||||||||||||| || ||||||||| |||| || ||||||| ||||||| |
|
|
| T |
44344457 |
ggctaaaatatggttttagttcccgcaaatatgtctcgtttcggttttaatccttgt |
44344513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #207
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 291 - 343
Target Start/End: Original strand, 44841471 - 44841523
Alignment:
| Q |
291 |
accccacttttgtgatgatttgcatacgtgacacattataactgaaccaattt |
343 |
Q |
| |
|
|||||||||||||||||||||| | ||||| ||||| || |||||||| |||| |
|
|
| T |
44841471 |
accccacttttgtgatgatttggacacgtggcacatgatgactgaacccattt |
44841523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #208
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 44958506 - 44958454
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||| |||| |||||| |||||||| |||| |||||||||||||| |
|
|
| T |
44958506 |
ggctaaaatatgattttggtccctacaaatatgtctcgttttggttttagtcc |
44958454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #209
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 45228615 - 45228667
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| | ||| |||||||||||||| ||| |||||||||| |
|
|
| T |
45228615 |
ggctaaaatatggttttgggccccgcaaatatgcctcgtttttgttttagtcc |
45228667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #210
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 179 - 223
Target Start/End: Original strand, 45671220 - 45671264
Alignment:
| Q |
179 |
aatatggttttagtccctgcaaatatgcctcggtttggttttagt |
223 |
Q |
| |
|
|||||||||||||||| |||||||||| |||| ||| |||||||| |
|
|
| T |
45671220 |
aatatggttttagtccatgcaaatatgtctcgttttagttttagt |
45671264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #211
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 46829312 - 46829260
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| |||||||||||||| ||| |||||||||||||| |
|
|
| T |
46829312 |
ggctaaaatatggttttgatccctgcaaatatgtctcattttggttttagtcc |
46829260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 66; Significance: 6e-29; HSPs: 160)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 66; E-Value: 6e-29
Query Start/End: Original strand, 173 - 344
Target Start/End: Complemental strand, 15076204 - 15076036
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgtnnnnnnnnnnnnnnttgtttttggtccctgcaaaannnnnnnn |
272 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |||||||||||||| || ||||||||||||||||||||| |
|
|
| T |
15076204 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg---gtaaaaaaaaaattgtttttggtccctgcaaaattttttgt |
15076108 |
T |
 |
| Q |
273 |
nnnngaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15076107 |
ttttgaaaatagtccctgaccccacttttatgatgatttgcatacgtgacacattataactgaaccaatttt |
15076036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 173 - 344
Target Start/End: Original strand, 34582529 - 34582698
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgtnnnnnnnnnnnnnnttgtttttggtccctgcaaaannnnnnnn |
272 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
34582529 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaactt--ttgtttttggtccctgcaaaattttttgt |
34582626 |
T |
 |
| Q |
273 |
nnnngaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||||| | |||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
34582627 |
ttttgaaaatagtccctgatcccacttttgtgatgatttgcatacgtggcacattataactgaaccaatttt |
34582698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 64; E-Value: 9e-28
Query Start/End: Original strand, 277 - 348
Target Start/End: Complemental strand, 17321453 - 17321382
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttatag |
348 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
17321453 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttatag |
17321382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 64; E-Value: 9e-28
Query Start/End: Original strand, 277 - 348
Target Start/End: Complemental strand, 17321586 - 17321515
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttatag |
348 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
17321586 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaattttatag |
17321515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 64; E-Value: 9e-28
Query Start/End: Original strand, 277 - 344
Target Start/End: Complemental strand, 31398440 - 31398373
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31398440 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
31398373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 173 - 344
Target Start/End: Complemental strand, 33801743 - 33801575
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgtnnnnnnnnnnnnnnttgtttttggtccctgcaaaannnnnnnn |
272 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |||||||||||||| || |||||||||||||||||||| |
|
|
| T |
33801743 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg---gtaaaaaaaaaattgtttttggtccctgcaaatttttttgt |
33801647 |
T |
 |
| Q |
273 |
nnnngaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
33801646 |
ttttgaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaatttt |
33801575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 61; E-Value: 6e-26
Query Start/End: Original strand, 173 - 344
Target Start/End: Complemental strand, 30929044 - 30928877
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgtnnnnnnnnnnnnnnttgtttttggtccctgcaaaannnnnnnn |
272 |
Q |
| |
|
||||| |||||| ||||||||||||||||||||||||| |||||||||||||| ||| ||||||||||||| ||||||| |
|
|
| T |
30929044 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaat----ttgtttttggtccttgcaaaattttttgt |
30928949 |
T |
 |
| Q |
273 |
nnnngaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
30928948 |
ttttgaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataacttaaccaatttt |
30928877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 61; E-Value: 6e-26
Query Start/End: Original strand, 174 - 344
Target Start/End: Original strand, 31166871 - 31167038
Alignment:
| Q |
174 |
gctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgtnnnnnnnnnnnnnnttgtttttggtccctgcaaaannnnnnnnn |
273 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||| |||||||||||||| || ||||||||||||||||||||| |
|
|
| T |
31166871 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg---gtaaaaataaaattgtttttggtccctgcaaaattttttgtt |
31166967 |
T |
 |
| Q |
274 |
nnngaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||||| |||||||||||||||| ||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
31166968 |
tttgaaaatagtccctgaccccacttttgtgattatttgcatacgtggcacattataactgaaccaatttt |
31167038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 277 - 344
Target Start/End: Complemental strand, 2616134 - 2616067
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2616134 |
gaaaatagtccctgaccacacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
2616067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 277 - 348
Target Start/End: Original strand, 10091135 - 10091206
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttatag |
348 |
Q |
| |
|
||||||||||| | ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10091135 |
gaaaatagtccatgaccccacttttatgatgatttgcatacgtgacacattataactgaaccaattttatag |
10091206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 277 - 344
Target Start/End: Complemental strand, 14655669 - 14655602
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
14655669 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaatttt |
14655602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 277 - 344
Target Start/End: Original strand, 15116773 - 15116840
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15116773 |
gaaaatagtccctgtccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
15116840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 277 - 344
Target Start/End: Original strand, 24273939 - 24274006
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
24273939 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaatttt |
24274006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 59; E-Value: 9e-25
Query Start/End: Original strand, 278 - 344
Target Start/End: Original strand, 26375794 - 26375860
Alignment:
| Q |
278 |
aaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
|||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26375794 |
aaaatagtccctaacctcacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
26375860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #15
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 173 - 344
Target Start/End: Original strand, 8680775 - 8680944
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgtnnnnnnnnnnnnnnttgtttttggtccctgcaaaannnnnnnn |
272 |
Q |
| |
|
||||| |||||| ||||||||||||||||||||||||| |||||||||||||| || ||||||||||||||||||||| |
|
|
| T |
8680775 |
ggctaaaatatgtttttagtccctgcaaatatgcctcgttttggttttagtccctg--gtaaaaaaaaaatttgtttttggtccctgcaaaattttttgt |
8680872 |
T |
 |
| Q |
273 |
nnnngaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||| |||||||||||| |||||||||| |
|
|
| T |
8680873 |
ttttgaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataacttaaccaatttt |
8680944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #16
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 279 - 344
Target Start/End: Original strand, 15962131 - 15962196
Alignment:
| Q |
279 |
aaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
15962131 |
aaatagtccctaaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaatttt |
15962196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #17
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 277 - 348
Target Start/End: Original strand, 1890161 - 1890232
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttatag |
348 |
Q |
| |
|
||||||||||||| ||| |||||||||||| ||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
1890161 |
gaaaatagtccctgacctcacttttgtgataatttgcatacgtgacacattataaccgaaccaattttatag |
1890232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #18
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 278 - 344
Target Start/End: Original strand, 317911 - 317977
Alignment:
| Q |
278 |
aaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||| || | |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
317911 |
aaaatagtctctgatcccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
317977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #19
Raw Score: 54; E-Value: 8e-22
Query Start/End: Original strand, 173 - 344
Target Start/End: Original strand, 7155797 - 7155965
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgtnnnnnnnnnnnnnnttgtttttggtccctgcaaaannnnnnnn |
272 |
Q |
| |
|
||||| ||||| |||||||||||||||||||||||||| |||||||||||||| || ||||||||||||||||||||| |
|
|
| T |
7155797 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg---gtaaaaaaaaaattgtttttggtccctgcaaaattttttgt |
7155893 |
T |
 |
| Q |
273 |
nnnngaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||| || |||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
7155894 |
ttttgaaaatagtttctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaatttt |
7155965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #20
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 277 - 344
Target Start/End: Complemental strand, 777939 - 777871
Alignment:
| Q |
277 |
gaaaatagtccc-tcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
|||||||||||| | |||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
777939 |
gaaaatagtcccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaatttt |
777871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #21
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 277 - 344
Target Start/End: Complemental strand, 494661 - 494594
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |||||||||| ||||||||||||||| ||||||| |
|
|
| T |
494661 |
gaaaatagtccctgaccccacttttgtgatgatctgcatacgtggcacattataactgaatcaatttt |
494594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #22
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 277 - 344
Target Start/End: Complemental strand, 543622 - 543555
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||| | |||||||||||||||||||||||||||||| |||||||||||||||| |||||| |
|
|
| T |
543622 |
gaaaatagtccatgaccccacttttgtgatgatttgcatacgtggcacattataactgaacaaatttt |
543555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #23
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 277 - 344
Target Start/End: Complemental strand, 3356400 - 3356333
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
|||||||||| || |||||||||||||| | ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3356400 |
gaaaatagtctctgaccccacttttgtgtttatttgcatacgtgacacattataactgaaccaatttt |
3356333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #24
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 277 - 344
Target Start/End: Original strand, 11129302 - 11129369
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||| || || ||||||||||||||||| |
|
|
| T |
11129302 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcagatgataactgaaccaatttt |
11129369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #25
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 277 - 344
Target Start/End: Complemental strand, 19296305 - 19296238
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||| |||| ||| ||||||||||||||||||||||| |
|
|
| T |
19296305 |
gaaaatagtccctgaccccacttttgtgatgatttacatatgtggcacattataactgaaccaatttt |
19296238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #26
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 277 - 344
Target Start/End: Complemental strand, 24692880 - 24692813
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||||| ||| |||||||||||||||||||||||||| |||||||||||||||| |||||| |
|
|
| T |
24692880 |
gaaaatagtccctgacctcacttttgtgatgatttgcatacgtggcacattataactgaactaatttt |
24692813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #27
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 278 - 344
Target Start/End: Complemental strand, 6468570 - 6468504
Alignment:
| Q |
278 |
aaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
|||||||||||| |||||| ||||||||||||||||||||||||||||| || |||||||||||||| |
|
|
| T |
6468570 |
aaaatagtccctgaccccatttttgtgatgatttgcatacgtgacacatgatgactgaaccaatttt |
6468504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #28
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 278 - 344
Target Start/End: Complemental strand, 6591339 - 6591273
Alignment:
| Q |
278 |
aaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
|||||||| ||| || |||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
6591339 |
aaaatagtgcctgactccacttttgtgatgatttgcatacgtgacacattataactaaaccaatttt |
6591273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #29
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 278 - 344
Target Start/End: Complemental strand, 7324091 - 7324025
Alignment:
| Q |
278 |
aaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
|||||||||||| ||||||||||| |||||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
7324091 |
aaaatagtccctgaccccacttttatgatgatttgcatacggggcacattataactgaaccaatttt |
7324025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #30
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 173 - 344
Target Start/End: Original strand, 32885673 - 32885841
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgtnnnnnnnnnnnnnnttgtttttggtccctgcaaaannnnnnnn |
272 |
Q |
| |
|
||||| |||||||||||| ||||||||||||||||||| |||||||||||||| || ||||||||||||||||||||| |
|
|
| T |
32885673 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtccctg---gtaaaaaaaaaattgtttttggtccctgcaaaattttttgt |
32885769 |
T |
 |
| Q |
273 |
nnnngaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
|||||||||| || ||| ||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
32885770 |
ttttgaaaatagtctctgcccctacttttgtgatgatttgcatacgtggcacattataactgaaccaatttt |
32885841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #31
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 173 - 229
Target Start/End: Original strand, 494405 - 494461
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgt |
229 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
494405 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccttgt |
494461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #32
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 173 - 229
Target Start/End: Original strand, 3356142 - 3356198
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgt |
229 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
3356142 |
ggctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagtccttgt |
3356198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #33
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 7156160 - 7156108
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
7156160 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
7156108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #34
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 15962389 - 15962337
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
15962389 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
15962337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #35
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 173 - 229
Target Start/End: Original strand, 17771911 - 17771967
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgt |
229 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
17771911 |
ggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccttgt |
17771967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #36
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 24274131 - 24274079
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
24274131 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
24274079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #37
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 179 - 225
Target Start/End: Original strand, 543367 - 543413
Alignment:
| Q |
179 |
aatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
543367 |
aatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
543413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #38
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 179 - 225
Target Start/End: Complemental strand, 3356492 - 3356446
Alignment:
| Q |
179 |
aatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
3356492 |
aatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
3356446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #39
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 278 - 344
Target Start/End: Complemental strand, 19275939 - 19275873
Alignment:
| Q |
278 |
aaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
|||||||||||| |||||| ||||||||||||||||||||||| ||||| || |||||||| ||||| |
|
|
| T |
19275939 |
aaaatagtccctgaccccatttttgtgatgatttgcatacgtggcacatgatgactgaacctatttt |
19275873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #40
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 278 - 344
Target Start/End: Original strand, 21995167 - 21995233
Alignment:
| Q |
278 |
aaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
|||||||||||| |||||| ||||||||||||||||||||||| ||||| || |||||||| ||||| |
|
|
| T |
21995167 |
aaaatagtccctgaccccatttttgtgatgatttgcatacgtggcacatgatgactgaacctatttt |
21995233 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #41
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 179 - 225
Target Start/End: Complemental strand, 26376039 - 26375993
Alignment:
| Q |
179 |
aatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
26376039 |
aatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
26375993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #42
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 278 - 344
Target Start/End: Original strand, 33131626 - 33131692
Alignment:
| Q |
278 |
aaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
|||||||||||| |||| | ||||||||||||||||||||||||||||| || |||||||| ||||| |
|
|
| T |
33131626 |
aaaatagtccctaaccctatttttgtgatgatttgcatacgtgacacatgatgactgaaccgatttt |
33131692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #43
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 173 - 226
Target Start/End: Original strand, 12419708 - 12419761
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcct |
226 |
Q |
| |
|
||||| |||||||||||| ||||||||||||||||||| ||||||||||||||| |
|
|
| T |
12419708 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtcct |
12419761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #44
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 1007509 - 1007457
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
1007509 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
1007457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #45
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 1890452 - 1890400
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |||| ||||||||| |
|
|
| T |
1890452 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtcc |
1890400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #46
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 2615872 - 2615924
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||||||||||||||||||||||| ||||| |||||||||||||| |
|
|
| T |
2615872 |
ggctaaaatatggttttagtccctgcaaatatacctcgttttggttttagtcc |
2615924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #47
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 229
Target Start/End: Complemental strand, 3276354 - 3276298
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgt |
229 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||| |||| |||||||||||||||||| |
|
|
| T |
3276354 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccttgt |
3276298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #48
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 3414387 - 3414439
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
3414387 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
3414439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #49
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 3969009 - 3968957
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
3969009 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
3968957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #50
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 8681116 - 8681064
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||| | |||||||||||||| |
|
|
| T |
8681116 |
ggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtcc |
8681064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #51
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 229
Target Start/End: Complemental strand, 9896637 - 9896581
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgt |
229 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| || | |||||||||||||||||| |
|
|
| T |
9896637 |
ggctaaaatatggttttagtccctgcaaatatgtcttgttttggttttagtccttgt |
9896581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #52
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 12419938 - 12419886
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||||||||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
12419938 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtcc |
12419886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #53
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 14655379 - 14655431
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
14655379 |
ggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtcc |
14655431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #54
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 15962027 - 15962079
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
15962027 |
ggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtcc |
15962079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #55
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 229
Target Start/End: Complemental strand, 19296407 - 19296351
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgt |
229 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |||||||||| ||| ||| |
|
|
| T |
19296407 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttaatccctgt |
19296351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #56
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 21994403 - 21994351
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
21994403 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
21994351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #57
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 21995064 - 21995116
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||||||||||||| |||||||||| |||||||||||||| |
|
|
| T |
21995064 |
ggctaaaatatggttttagtccctgcatatatgcctcgttttggttttagtcc |
21995116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #58
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 22543354 - 22543406
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
22543354 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
22543406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #59
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 22792899 - 22792847
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||| |||||||||||||||||||||| |||||||||||||| |
|
|
| T |
22792899 |
ggctaaaatatggttctagtccctgcaaatatgcctcgttttggttttagtcc |
22792847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #60
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 22822651 - 22822599
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |||| ||||||||| |
|
|
| T |
22822651 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtcc |
22822599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #61
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 25137357 - 25137305
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
25137357 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
25137305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #62
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 25431854 - 25431802
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |||| |||||||||||||| |
|
|
| T |
25431854 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
25431802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #63
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 30928681 - 30928733
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |||| |||||||||||||| |
|
|
| T |
30928681 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
30928733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #64
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 34582892 - 34582840
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||||||||||||||||||||||| ||||| |||||||||||||| |
|
|
| T |
34582892 |
ggctaaaatatggttttagtccctgcaaatatacctcgttttggttttagtcc |
34582840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #65
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 174 - 229
Target Start/End: Complemental strand, 494751 - 494696
Alignment:
| Q |
174 |
gctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgt |
229 |
Q |
| |
|
|||| ||||||||||||||||||||||||||| |||| |||||||||| ||||||| |
|
|
| T |
494751 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaatccttgt |
494696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #66
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 174 - 225
Target Start/End: Original strand, 14428651 - 14428702
Alignment:
| Q |
174 |
gctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
|||| |||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
14428651 |
gctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtcc |
14428702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #67
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 174 - 225
Target Start/End: Original strand, 23770162 - 23770213
Alignment:
| Q |
174 |
gctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
|||| ||||||||||||||||||||||||||| |||| |||||||||||||| |
|
|
| T |
23770162 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
23770213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #68
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 284 - 343
Target Start/End: Original strand, 24901347 - 24901406
Alignment:
| Q |
284 |
gtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattt |
343 |
Q |
| |
|
|||||| || ||||||||||||||||||||| ||||||||||| ||||||||||| |||| |
|
|
| T |
24901347 |
gtccctgactccacttttgtgatgatttgcacacgtgacacatgataactgaacccattt |
24901406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #69
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 278 - 344
Target Start/End: Complemental strand, 2373391 - 2373325
Alignment:
| Q |
278 |
aaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||| | || |||||| ||||||||||||||||||||||||||||| || |||||||| ||||| |
|
|
| T |
2373391 |
aaaatagccgctgaccccatttttgtgatgatttgcatacgtgacacatgatgactgaacccatttt |
2373325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #70
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 179 - 225
Target Start/End: Complemental strand, 5286945 - 5286899
Alignment:
| Q |
179 |
aatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
5286945 |
aatatggttttagtccctgcaaatatgcctcattttggttttagtcc |
5286899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #71
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 179 - 229
Target Start/End: Complemental strand, 7324186 - 7324136
Alignment:
| Q |
179 |
aatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgt |
229 |
Q |
| |
|
|||||||||||||||||||||||||||| ||| |||||||||||||| ||| |
|
|
| T |
7324186 |
aatatggttttagtccctgcaaatatgcttcgttttggttttagtccctgt |
7324136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #72
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 179 - 225
Target Start/End: Complemental strand, 12176637 - 12176591
Alignment:
| Q |
179 |
aatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||||||||||||||||||||||||| |||| |||||||||||||| |
|
|
| T |
12176637 |
aatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
12176591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #73
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 173 - 223
Target Start/End: Complemental strand, 12299140 - 12299090
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagt |
223 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||||||| |||||||||||| |
|
|
| T |
12299140 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagt |
12299090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #74
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 278 - 344
Target Start/End: Original strand, 14428751 - 14428817
Alignment:
| Q |
278 |
aaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||| || |||||| ||||||||||||||||||||||| ||||| || |||||||| ||||| |
|
|
| T |
14428751 |
aaaatagtctctgaccccatttttgtgatgatttgcatacgtggcacatgatgactgaaccgatttt |
14428817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #75
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 179 - 229
Target Start/End: Complemental strand, 14428944 - 14428894
Alignment:
| Q |
179 |
aatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgt |
229 |
Q |
| |
|
|||||||||||||||| ||||||||||| ||| |||||||||||||||||| |
|
|
| T |
14428944 |
aatatggttttagtccttgcaaatatgcttcgttttggttttagtccttgt |
14428894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #76
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 173 - 223
Target Start/End: Complemental strand, 19321131 - 19321081
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagt |
223 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||||||| |||||||||||| |
|
|
| T |
19321131 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagt |
19321081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #77
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 173 - 223
Target Start/End: Complemental strand, 20467718 - 20467668
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagt |
223 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||||||| |||||||||||| |
|
|
| T |
20467718 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagt |
20467668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #78
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 173 - 223
Target Start/End: Original strand, 24273828 - 24273878
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagt |
223 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| ||| |||||||||||| |
|
|
| T |
24273828 |
ggctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagt |
24273878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #79
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 179 - 225
Target Start/End: Complemental strand, 34990309 - 34990263
Alignment:
| Q |
179 |
aatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
|||||||||||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
34990309 |
aatatggttttagtccctgcaaatatgcttcgttttggttttagtcc |
34990263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #80
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 1007124 - 1007176
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||| ||| |||||||||||||| |
|
|
| T |
1007124 |
ggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtcc |
1007176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #81
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 2373179 - 2373231
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||| | ||||||| |||||| |
|
|
| T |
2373179 |
ggctaaaatatggttttagtccctgcaaatatgccttgttttggttatagtcc |
2373231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #82
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 3968645 - 3968697
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||| |||| |||||||||||||| |
|
|
| T |
3968645 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
3968697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #83
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 277 - 344
Target Start/End: Original strand, 5286687 - 5286757
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgt---gacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||| || | |||||||||| |||||||||||| |
|
|
| T |
5286687 |
gaaaatagtccctggccccacttttgtgatgatttgcatatgtggcggcacattataaatgaaccaatttt |
5286757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #84
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 6412218 - 6412270
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||| |||| |||||||||||||| |
|
|
| T |
6412218 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
6412270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #85
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 6412579 - 6412527
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||||||| |||| ||||||||| |
|
|
| T |
6412579 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttgattttagtcc |
6412527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #86
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 6468310 - 6468362
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| | | |||||||||||||| |
|
|
| T |
6468310 |
ggctaaaatatggttttagtccctgcaaatatgctttgttttggttttagtcc |
6468362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #87
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 229
Target Start/End: Complemental strand, 8170151 - 8170095
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgt |
229 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||| |||| ||||||||||||| |||| |
|
|
| T |
8170151 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcattgt |
8170095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #88
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 10910964 - 10910912
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||| |||| |||||||||||||| |
|
|
| T |
10910964 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
10910912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #89
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 11448537 - 11448589
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||| |||||||||||||||||||| |||| |||||||||||||| |
|
|
| T |
11448537 |
ggctaaaatatgattttagtccctgcaaatatgtctcgttttggttttagtcc |
11448589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #90
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 11449169 - 11449117
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||||||||||||| ||||||||||||||| ||||||| |||||| |
|
|
| T |
11449169 |
ggctaaaatatggttttagtccttgcaaatatgcctcgttttggttgtagtcc |
11449117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #91
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 12612359 - 12612307
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||||| ||||||||||||||||||||||| ||| |||||||||| |
|
|
| T |
12612359 |
ggctaaaatatggtgttagtccctgcaaatatgcctcgttttagttttagtcc |
12612307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #92
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 13268109 - 13268161
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||||||| || ||||||||||| |
|
|
| T |
13268109 |
ggctaaaatatggttttggtccctgcaaatatgcctcgtttaggttttagtcc |
13268161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #93
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 19129336 - 19129388
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||| ||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
19129336 |
ggctacaatatggctttggtccctgcaaatatgcctcgttttggttttagtcc |
19129388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #94
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 19690393 - 19690445
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||| |||| |||||||||||||| |
|
|
| T |
19690393 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
19690445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #95
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 21147404 - 21147456
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||| ||| |||||||||||||| |
|
|
| T |
21147404 |
ggctaaaatatggttttggtccctgcaaatatgcatcgttttggttttagtcc |
21147456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #96
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 21385251 - 21385303
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||| |||| |||||||||||||| |
|
|
| T |
21385251 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
21385303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #97
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 21385584 - 21385532
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
21385584 |
ggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtcc |
21385532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #98
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 21995425 - 21995373
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||||||||||||| ||||||||||||||| ||||| |||||||| |
|
|
| T |
21995425 |
ggctaaaatatggttttagtccttgcaaatatgcctcgttttggctttagtcc |
21995373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #99
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 22543718 - 22543666
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||| |||| |||||||||||||| |
|
|
| T |
22543718 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
22543666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #100
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 221
Target Start/End: Complemental strand, 23502540 - 23502492
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggtttta |
221 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |||| |||||||||| |
|
|
| T |
23502540 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
23502492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #101
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 24692979 - 24692927
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |||| |||| ||||||||| |
|
|
| T |
24692979 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttgcttttagtcc |
24692927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #102
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 25136994 - 25137046
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| ||| |||||||||||||||| |||||||||||||| |
|
|
| T |
25136994 |
ggctaaaatatggttttggtcgctgcaaatatgcctcgttttggttttagtcc |
25137046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #103
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 31167200 - 31167148
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |||| |||| ||||||||| |
|
|
| T |
31167200 |
ggctaaaatatggttttagtccctgcaaatatggctcgttttgattttagtcc |
31167148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #104
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 31198615 - 31198667
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||| |||| |||||||||||||| |
|
|
| T |
31198615 |
ggctaaaatatggttttggtccctgcaaatatggctcgttttggttttagtcc |
31198667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #105
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 229
Target Start/End: Complemental strand, 31398541 - 31398485
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgt |
229 |
Q |
| |
|
||||| |||||| |||||||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
31398541 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtccttgt |
31398485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #106
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 33131850 - 33131798
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
33131850 |
ggctaaaatatggttttagtctttgcaaatatgcctcgttttggttttagtcc |
33131798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #107
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 33808620 - 33808672
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||||||||||| |||||||||||| |||| ||||||||| |
|
|
| T |
33808620 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttgattttagtcc |
33808672 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #108
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 174 - 226
Target Start/End: Original strand, 34989962 - 34990014
Alignment:
| Q |
174 |
gctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcct |
226 |
Q |
| |
|
|||| |||||| ||||||||||||||||||||||||| |||| |||||||||| |
|
|
| T |
34989962 |
gctaaaatatgcttttagtccctgcaaatatgcctcgttttgattttagtcct |
34990014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #109
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 173 - 220
Target Start/End: Complemental strand, 2616240 - 2616193
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggtttt |
220 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||| | ||||||||| |
|
|
| T |
2616240 |
ggctaaaatatggttttagtccctgcaaatatgccttgttttggtttt |
2616193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #110
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 173 - 220
Target Start/End: Original strand, 6591115 - 6591162
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggtttt |
220 |
Q |
| |
|
||||| ||||||||||||||||| |||||||||||||| ||||||||| |
|
|
| T |
6591115 |
ggctaaaatatggttttagtccccgcaaatatgcctcgttttggtttt |
6591162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #111
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 173 - 224
Target Start/End: Original strand, 12757610 - 12757661
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtc |
224 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||| |||| ||||||||||||| |
|
|
| T |
12757610 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
12757661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #112
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 173 - 220
Target Start/End: Original strand, 23502237 - 23502284
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggtttt |
220 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
23502237 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttt |
23502284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #113
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 173 - 224
Target Start/End: Original strand, 24901239 - 24901290
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtc |
224 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||| |||| ||||||||||||| |
|
|
| T |
24901239 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
24901290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #114
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 173 - 223
Target Start/End: Complemental strand, 778042 - 777992
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagt |
223 |
Q |
| |
|
||||| |||||||||||| ||||||||||||||||||| ||| |||||||| |
|
|
| T |
778042 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttagttttagt |
777992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #115
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 179 - 225
Target Start/End: Original strand, 1890065 - 1890111
Alignment:
| Q |
179 |
aatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||||||||||||||||| |||||||||||| |||| ||||||||| |
|
|
| T |
1890065 |
aatatggttttagtccctgtaaatatgcctcgttttgattttagtcc |
1890111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #116
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 179 - 225
Target Start/End: Original strand, 10091042 - 10091088
Alignment:
| Q |
179 |
aatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||||||||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
10091042 |
aatatggttttagtccctgcaaatatgtttcgttttggttttagtcc |
10091088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #117
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 179 - 225
Target Start/End: Original strand, 13617535 - 13617581
Alignment:
| Q |
179 |
aatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||||||||| ||||||||||||||| |||| |||||||||||||| |
|
|
| T |
13617535 |
aatatggttttggtccctgcaaatatggctcgttttggttttagtcc |
13617581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #118
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 173 - 223
Target Start/End: Original strand, 17765009 - 17765059
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagt |
223 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||| |||| |||||||||||| |
|
|
| T |
17765009 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
17765059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #119
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 179 - 225
Target Start/End: Original strand, 20467357 - 20467403
Alignment:
| Q |
179 |
aatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
20467357 |
aatatagttttggtccctgcaaatatgcctcgttttggttttagtcc |
20467403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #120
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 173 - 223
Target Start/End: Original strand, 22822307 - 22822357
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagt |
223 |
Q |
| |
|
||||| ||||||||||||||| |||||||||| ||||| |||||||||||| |
|
|
| T |
22822307 |
ggctaaaatatggttttagtctctgcaaatatacctcgttttggttttagt |
22822357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #121
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 173 - 222
Target Start/End: Original strand, 317812 - 317861
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttag |
222 |
Q |
| |
|
||||| ||||| ||||||||||||||||||||| |||| ||||||||||| |
|
|
| T |
317812 |
ggctaaaatatagttttagtccctgcaaatatgtctcgttttggttttag |
317861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #122
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 294 - 343
Target Start/End: Original strand, 13617648 - 13617697
Alignment:
| Q |
294 |
ccacttttgtgatgatttgcatacgtgacacattataactgaaccaattt |
343 |
Q |
| |
|
||||||||||||||||||||| ||||| ||||| ||||||||||| |||| |
|
|
| T |
13617648 |
ccacttttgtgatgatttgcacacgtggcacatgataactgaacccattt |
13617697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #123
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 173 - 210
Target Start/End: Complemental strand, 23770439 - 23770402
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcg |
210 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
23770439 |
ggctaaaatatggttttagtccctgcaaatatgcctcg |
23770402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #124
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 318097 - 318045
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||||||||| |||||||||||||| ||| |||||||||||||| |
|
|
| T |
318097 |
ggctaaaatatggttttaatccctgcaaatatgtttcgttttggttttagtcc |
318045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #125
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 777677 - 777729
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||| ||||||| ||||||||||| ||||| |||||||||||||| |
|
|
| T |
777677 |
ggctaaaatatgattttagttcctgcaaatatacctcgttttggttttagtcc |
777729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #126
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 3414752 - 3414700
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| ||||||| ||||||| |||| |||||||||||||| |
|
|
| T |
3414752 |
ggctaaaatatggttttggtccctgtaaatatgtctcgttttggttttagtcc |
3414700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #127
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 179 - 223
Target Start/End: Complemental strand, 6591436 - 6591392
Alignment:
| Q |
179 |
aatatggttttagtccctgcaaatatgcctcggtttggttttagt |
223 |
Q |
| |
|
|||||||||||||| |||||||||||| |||| |||||||||||| |
|
|
| T |
6591436 |
aatatggttttagtacctgcaaatatgtctcgttttggttttagt |
6591392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #128
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 173 - 229
Target Start/End: Complemental strand, 11129543 - 11129487
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgt |
229 |
Q |
| |
|
||||| |||||| ||||| ||||||||||||||||||| ||||||||| || ||||| |
|
|
| T |
11129543 |
ggctaaaatatgattttactccctgcaaatatgcctcgttttggttttcgttcttgt |
11129487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #129
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 291 - 344
Target Start/End: Original strand, 11448652 - 11448709
Alignment:
| Q |
291 |
accccacttttgtgatgatttgcatacg----tgacacattataactgaaccaatttt |
344 |
Q |
| |
|
|||| ||||||||||||||||||||||| |||||||||||||||||| ||||||| |
|
|
| T |
11448652 |
accctacttttgtgatgatttgcatacgtacgtgacacattataactgaatcaatttt |
11448709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #130
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 185 - 225
Target Start/End: Complemental strand, 13617804 - 13617764
Alignment:
| Q |
185 |
gttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
13617804 |
gttttggtccctgcaaatatgcctcgttttggttttagtcc |
13617764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #131
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 14656260 - 14656208
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| |||| |||||||||| |||| |||||||||||||| |
|
|
| T |
14656260 |
ggctaaaatatggttttggtccttgcaaatatgtctcgttttggttttagtcc |
14656208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #132
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 173 - 209
Target Start/End: Complemental strand, 15117040 - 15117004
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctc |
209 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
15117040 |
ggctaaaatatggttttagtccctgcaaatatgcctc |
15117004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #133
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 291 - 343
Target Start/End: Original strand, 15722726 - 15722778
Alignment:
| Q |
291 |
accccacttttgtgatgatttgcatacgtgacacattataactgaaccaattt |
343 |
Q |
| |
|
||||||||||| |||| ||||||| ||||||||||| ||||||||||| |||| |
|
|
| T |
15722726 |
accccacttttatgatcatttgcacacgtgacacatgataactgaacccattt |
15722778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #134
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 277 - 325
Target Start/End: Original strand, 17772014 - 17772062
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacaca |
325 |
Q |
| |
|
|||||||||| || |||||| ||||||||||||||||||||||| |||| |
|
|
| T |
17772014 |
gaaaatagtctctgaccccatttttgtgatgatttgcatacgtggcaca |
17772062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #135
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 18024375 - 18024323
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||| || | |||||||||||||| |
|
|
| T |
18024375 |
ggctaaaatatggttttggtccctgcaaatatgtcttgttttggttttagtcc |
18024323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #136
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 19267565 - 19267617
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| ||||||| |||||||| ||| |||||||||||||| |
|
|
| T |
19267565 |
ggctaaaatatggttttggtccctgtaaatatgcttcgttttggttttagtcc |
19267617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #137
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 19296108 - 19296160
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| || ||||||||||||||||||||||||| ||| |||| ||||||||| |
|
|
| T |
19296108 |
ggctaaaacatggttttagtccctgcaaatatgcgtcgttttgattttagtcc |
19296160 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #138
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 21993787 - 21993839
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| |||||||||||||| |||| |||||||||||||| |
|
|
| T |
21993787 |
ggctaaaatatggttttgctccctgcaaatatgtctcgttttggttttagtcc |
21993839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #139
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 173 - 221
Target Start/End: Original strand, 26375693 - 26375741
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggtttta |
221 |
Q |
| |
|
||||| |||||||||||| |||||||||||||| |||| |||||||||| |
|
|
| T |
26375693 |
ggctaaaatatggttttaatccctgcaaatatgtctcgttttggtttta |
26375741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #140
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 30239293 - 30239345
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||| ||||||| |||||||||||| |||| |||||||||||||| |
|
|
| T |
30239293 |
ggctaaaatatgattttagttcctgcaaatatgtctcgttttggttttagtcc |
30239345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #141
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 31186591 - 31186539
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| || ||||||||||||||||| ||| |||||||||| |
|
|
| T |
31186591 |
ggctaaaatatggtttttgtgcctgcaaatatgcctcgtttttgttttagtcc |
31186539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #142
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 296 - 343
Target Start/End: Original strand, 1214815 - 1214862
Alignment:
| Q |
296 |
acttttgtgatgatttgcatacgtgacacattataactgaaccaattt |
343 |
Q |
| |
|
||||||||||||||||||| ||||||||||| || |||||||| |||| |
|
|
| T |
1214815 |
acttttgtgatgatttgcacacgtgacacatgatgactgaacccattt |
1214862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #143
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 292 - 335
Target Start/End: Complemental strand, 25121380 - 25121337
Alignment:
| Q |
292 |
ccccacttttgtgatgatttgcatacgtgacacattataactga |
335 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| || ||||| |
|
|
| T |
25121380 |
ccccacttttgtgatgatttgcacacgtgacacatgatgactga |
25121337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #144
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 309 - 344
Target Start/End: Original strand, 25431672 - 25431707
Alignment:
| Q |
309 |
tttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||| |
|
|
| T |
25431672 |
tttgcatacgtgacacattataactaaaccaatttt |
25431707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #145
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 174 - 225
Target Start/End: Complemental strand, 30479421 - 30479370
Alignment:
| Q |
174 |
gctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
|||| ||||||||||| || | ||||||||||||||| |||||||||||||| |
|
|
| T |
30479421 |
gctaaaatatggttttggttcatgcaaatatgcctcgttttggttttagtcc |
30479370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #146
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 179 - 225
Target Start/End: Original strand, 12298828 - 12298874
Alignment:
| Q |
179 |
aatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||||||||| ||||||||||||||| |||| ||| |||||||||| |
|
|
| T |
12298828 |
aatatggttttggtccctgcaaatatgtctcgttttcgttttagtcc |
12298874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #147
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 298 - 344
Target Start/End: Complemental strand, 12612236 - 12612190
Alignment:
| Q |
298 |
ttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||||||||||||||| ||||| || |||||||| ||||| |
|
|
| T |
12612236 |
ttttgtgatgatttgcatacgtggcacatgatgactgaaccgatttt |
12612190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #148
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 173 - 223
Target Start/End: Original strand, 15442937 - 15442987
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagt |
223 |
Q |
| |
|
||||| ||||||||||| |||||||||||||| ||||| |||| ||||||| |
|
|
| T |
15442937 |
ggctaaaatatggttttggtccctgcaaatatacctcgttttgattttagt |
15442987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #149
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 179 - 225
Target Start/End: Original strand, 18024017 - 18024063
Alignment:
| Q |
179 |
aatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||||||||| ||| ||||||||||||||| |||||||||||||| |
|
|
| T |
18024017 |
aatatggttttggtctttgcaaatatgcctcgttttggttttagtcc |
18024063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #150
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 294 - 343
Target Start/End: Complemental strand, 3276235 - 3276186
Alignment:
| Q |
294 |
ccacttttgtgatgatttgcatacgtgacacattataactgaaccaattt |
343 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| || ||||||| |||| |
|
|
| T |
3276235 |
ccacttttgtgatgatttgcacacgtgacacatgatgtctgaacccattt |
3276186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #151
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 183 - 224
Target Start/End: Complemental strand, 6564934 - 6564893
Alignment:
| Q |
183 |
tggttttagtccctgcaaatatgcctcggtttggttttagtc |
224 |
Q |
| |
|
||||||| ||||||||||||||| |||| ||||||||||||| |
|
|
| T |
6564934 |
tggttttggtccctgcaaatatgtctcgttttggttttagtc |
6564893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #152
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 294 - 343
Target Start/End: Original strand, 19320886 - 19320935
Alignment:
| Q |
294 |
ccacttttgtgatgatttgcatacgtgacacattataactgaaccaattt |
343 |
Q |
| |
|
||||||||||||||||||||| ||||| ||||| || |||||||| |||| |
|
|
| T |
19320886 |
ccacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt |
19320935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #153
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 294 - 343
Target Start/End: Original strand, 31198734 - 31198783
Alignment:
| Q |
294 |
ccacttttgtgatgatttgcatacgtgacacattataactgaaccaattt |
343 |
Q |
| |
|
||||||||||||||||||||| ||||| ||||| || |||||||| |||| |
|
|
| T |
31198734 |
ccacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt |
31198783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #154
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 543724 - 543672
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||| ||||||||||||||||||||| | | |||||||||| ||| |
|
|
| T |
543724 |
ggctaaaatatgattttagtccctgcaaatatgctttgttttggttttaatcc |
543672 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #155
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 1214996 - 1214944
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| || ||||||||||| |||| |||||||||||||| |
|
|
| T |
1214996 |
ggctaaaatatggttttgatctctgcaaatatgtctcgttttggttttagtcc |
1214944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #156
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 10910629 - 10910681
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| ||| || |||||||| |||| |||||||||||||| |
|
|
| T |
10910629 |
ggctaaaatatggttttggtctctacaaatatgtctcgttttggttttagtcc |
10910681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #157
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 13150750 - 13150698
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||||| ||| ||||||||||||| |||| |||||||||||||| |
|
|
| T |
13150750 |
ggctaaaatatggtattaacccctgcaaatatgtctcgttttggttttagtcc |
13150698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #158
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 284 - 320
Target Start/End: Original strand, 13268218 - 13268254
Alignment:
| Q |
284 |
gtccctcaccccacttttgtgatgatttgcatacgtg |
320 |
Q |
| |
|
|||||| |||||||||||||||||||||||| ||||| |
|
|
| T |
13268218 |
gtccctgaccccacttttgtgatgatttgcacacgtg |
13268254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #159
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 19129520 - 19129468
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||| |||| ||||||||||||||| | || |||||||||||||| |
|
|
| T |
19129520 |
ggctaaaatatgattttggtccctgcaaatatgtcacgttttggttttagtcc |
19129468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #160
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 25121496 - 25121444
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| || |||||||||||| ||| |||||||||||||| |
|
|
| T |
25121496 |
ggctaaaatatggttttggtgcctgcaaatatgtttcgttttggttttagtcc |
25121444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 65; Significance: 2e-28; HSPs: 243)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 173 - 344
Target Start/End: Complemental strand, 53717174 - 53717005
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgtnnnnnnnnnnnnnnttgtttttggtccctgcaaaannnnnnnn |
272 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |||||||||||||| ||| ||||||||| ||||||||||| |
|
|
| T |
53717174 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaacaaaaaaaat--ttgtttttgatccctgcaaaattttttgt |
53717077 |
T |
 |
| Q |
273 |
nnnngaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53717076 |
tttttaaaatagtccctaaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
53717005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 64; E-Value: 9e-28
Query Start/End: Original strand, 277 - 344
Target Start/End: Original strand, 13479371 - 13479438
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13479371 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
13479438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 179 - 344
Target Start/End: Original strand, 38054552 - 38054713
Alignment:
| Q |
179 |
aatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgtnnnnnnnnnnnnnnttgtttttggtccctgcaaaannnnnnnnnnnnga |
278 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||| ||| ||||||||||||||||||||| || |
|
|
| T |
38054552 |
aatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaaa----ttgtttttggtccctgcaaaattttttgtttttga |
38054647 |
T |
 |
| Q |
279 |
aaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||| | |||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
38054648 |
aaatagtccctgatcccacttttgtgatgatttgcatacgtgacacattataactgaatcaatttt |
38054713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 173 - 344
Target Start/End: Complemental strand, 50714565 - 50714397
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgtnnnnnnnnnnnnnnttgtttttggtccctgcaaaannnnnnnn |
272 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |||| |||||||||||||| || ||||||||||||||||||||| |
|
|
| T |
50714565 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg---gtaaaaaaaaaattgtttttggtccctgcaaaattttttgt |
50714469 |
T |
 |
| Q |
273 |
nnnngaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
50714468 |
ttttgaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaatttt |
50714397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 61; E-Value: 6e-26
Query Start/End: Original strand, 173 - 344
Target Start/End: Complemental strand, 29463913 - 29463745
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgtnnnnnnnnnnnnnnttgtttttggtccctgcaaaannnnnnnn |
272 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| ||||||||| |||| ||| ||||||||||||||||||||| |
|
|
| T |
29463913 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttggtccctgtaaaaaaaaaaa---ttgtttttggtccctgcaaaattttttgt |
29463817 |
T |
 |
| Q |
273 |
nnnngaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||||| |||||| |||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
29463816 |
ttttgaaaatagtccctgaccccatttttgtgatgatttgcatacgtgacacattataattgaaccaatttt |
29463745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 277 - 344
Target Start/End: Complemental strand, 24474861 - 24474794
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24474861 |
gaaaatagtccctgaccccacttttctgatgatttgcatacgtgacacattataactgaaccaatttt |
24474794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 277 - 344
Target Start/End: Complemental strand, 41920983 - 41920916
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41920983 |
gaaaatagtccctgaccctacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
41920916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 277 - 344
Target Start/End: Complemental strand, 51708926 - 51708859
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51708926 |
gaaaatagtccctgatcccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
51708859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 173 - 344
Target Start/End: Complemental strand, 6827874 - 6827705
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgtnnnnnnnnnnnnnnttgtttttggtccctgcaaaannnnnnnn |
272 |
Q |
| |
|
||||| |||||| ||||||||||||||||||||||||| |||||||||||||| || ||||||||||||||||||||| |
|
|
| T |
6827874 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctg--gtaaaaaaaaaatttgtttttggtccctgcaaaattttttgt |
6827777 |
T |
 |
| Q |
273 |
nnnngaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||||| | |||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
6827776 |
ttttgaaaatagtccctgatcccacttttgtgatgatttgcatacgtggcacattataactgaaccaatttt |
6827705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 173 - 344
Target Start/End: Complemental strand, 4279335 - 4279166
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgtnnnnnnnnnnnnnnttgtttttggtccctgcaaaannnnnnnn |
272 |
Q |
| |
|
||||| |||||| |||||||||||||||||||| |||| |||||||||||||||||| |||||||||||||| |||||| |
|
|
| T |
4279335 |
ggctaaaatatgattttagtccctgcaaatatggctcgttttggttttagtccttgtaataaggaaatt--ttgtttttggtcccagcaaaatattttgt |
4279238 |
T |
 |
| Q |
273 |
nnnngaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||| ||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
4279237 |
ttttgaaaatagtacctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaatttt |
4279166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 173 - 344
Target Start/End: Complemental strand, 52017870 - 52017701
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgtnnnnnnnnnnnnnnttgtttttggtccctgcaaaannnnnnnn |
272 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |||||||||||||| ||| |||||||| |||||||||||| |
|
|
| T |
52017870 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaagaaaatt--ttgtttttagtccctgcaaaattttttgt |
52017773 |
T |
 |
| Q |
273 |
nnnngaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||||| || ||||||||| ||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
52017772 |
ttttgaaaatagtccctgacaccacttttgcgatgatttgcatacgtggcacattataactgaaccaatttt |
52017701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 277 - 344
Target Start/End: Complemental strand, 18136014 - 18135947
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
|||||||||| || ||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
18136014 |
gaaaatagtcactgaccccacttttgtgatgatttgcatacgtgacacattataactaaaccaatttt |
18135947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 277 - 344
Target Start/End: Complemental strand, 27008306 - 27008239
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
|||||||||| || ||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
27008306 |
gaaaatagtctctgaccccacttttgtgatgatttgcatacgtgacacattataactaaaccaatttt |
27008239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 277 - 344
Target Start/End: Original strand, 34355065 - 34355132
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
34355065 |
gaaaatagtccctggccccacttttgtgatgatttgcatacgtggcacattataactgaaccaatttt |
34355132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 277 - 344
Target Start/End: Complemental strand, 34362044 - 34361977
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||| | |||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
34362044 |
gaaaatagtccttgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaatttt |
34361977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 277 - 344
Target Start/End: Original strand, 35415401 - 35415468
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||||| || ||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
35415401 |
gaaaatagtccctgactccacttttgtgatgatttgcatacgtggcacattataactgaaccaatttt |
35415468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 277 - 344
Target Start/End: Original strand, 36702101 - 36702168
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
36702101 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattatgactgaaccaatttt |
36702168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 277 - 344
Target Start/End: Complemental strand, 41346117 - 41346050
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||||| |||||| ||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
41346117 |
gaaaatagtccctgaccccatttttgtgatgatttgcatacgtggcacattataactgaaccaatttt |
41346050 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 277 - 344
Target Start/End: Complemental strand, 41620154 - 41620087
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||||| || ||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
41620154 |
gaaaatagtccctgactccacttttgtgatgatttgcatacgtggcacattataactgaaccaatttt |
41620087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 277 - 344
Target Start/End: Complemental strand, 49123222 - 49123155
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
|||||||||| || ||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
49123222 |
gaaaatagtcactgaccccacttttgtgatgatttgcatacgtgacacattataactaaaccaatttt |
49123155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 277 - 344
Target Start/End: Complemental strand, 55482369 - 55482302
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||| |||||||||| |||||||||||| |
|
|
| T |
55482369 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataattgaaccaatttt |
55482302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 278 - 348
Target Start/End: Original strand, 55072492 - 55072562
Alignment:
| Q |
278 |
aaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttatag |
348 |
Q |
| |
|
|||||||||||| || ||||||||| ||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
55072492 |
aaaatagtccctgacaccacttttgcgatgatttgcatacgtggcacattataactgaaccaattttatag |
55072562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 277 - 344
Target Start/End: Complemental strand, 123793 - 123726
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||||| |||| ||||||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
123793 |
gaaaatagtccctaaccctacttttgtggtgatttgcatacgtggcacattataactgaaccaatttt |
123726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 277 - 344
Target Start/End: Original strand, 3178784 - 3178851
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||||| ||||||||||| | ||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
3178784 |
gaaaatagtccctgaccccacttttttaatgatttgcatacatgacacattataactgaaccaatttt |
3178851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 277 - 344
Target Start/End: Complemental strand, 9446223 - 9446156
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||| |||||||||| |||||||||| |
|
|
| T |
9446223 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgaaacattataacaaaaccaatttt |
9446156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 277 - 344
Target Start/End: Complemental strand, 22584509 - 22584442
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||| | ||||||||| ||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
22584509 |
gaaaatagtccatgaccccacttctgtgatgatttgcatacatgacacattataactgaaccaatttt |
22584442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 277 - 344
Target Start/End: Original strand, 27427944 - 27428011
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||| |||| ||||||| |||||||||| |
|
|
| T |
27427944 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacaatataactaaaccaatttt |
27428011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #28
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 277 - 344
Target Start/End: Original strand, 32208642 - 32208709
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||||| |||| ||||||||||| ||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
32208642 |
gaaaatagtccctgaccctacttttgtgattatttgtatacgtgacacattataactgaaccaatttt |
32208709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #29
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 279 - 344
Target Start/End: Original strand, 13064260 - 13064325
Alignment:
| Q |
279 |
aaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||| ||||||||||| |||||||||| |
|
|
| T |
13064260 |
aaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataacaaaaccaatttt |
13064325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #30
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 173 - 229
Target Start/End: Complemental strand, 5052584 - 5052528
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgt |
229 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
5052584 |
ggctacaatatggttttagtccctgcaaatatgcctcgttttggttttagtccttgt |
5052528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #31
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 173 - 344
Target Start/End: Complemental strand, 16712691 - 16712525
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgtnnnnnnnnnnnnnnttgtttttggtccctgcaaaannnnnnnn |
272 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |||||||||||||| ||| |||||||||||| |||||||| |
|
|
| T |
16712691 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaa-----ttgtttttggtctctgcaaaattttttgt |
16712597 |
T |
 |
| Q |
273 |
nnnngaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
| ||||||||||| || ||||||||||||||||||||||| ||| |||||||||||| |||||||||| |
|
|
| T |
16712596 |
ttttgtaaatagtccctgacgccacttttgtgatgatttgcatatgtggcacattataacttaaccaatttt |
16712525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #32
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 173 - 344
Target Start/End: Original strand, 18205156 - 18205323
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgtnnnnnnnnnnnnnnttgtttttggtccctgcaaaannnnnnnn |
272 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |||||||||||||| | | ||||||||||||||||||||| |
|
|
| T |
18205156 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctat----aaaaaaaaaattgtttttggtccctgcaaaattttttgt |
18205251 |
T |
 |
| Q |
273 |
nnnngaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
|||||||||| | ||||||||||||||||||||||||||||||| |||||||| |||||| |||||| |
|
|
| T |
18205252 |
ttttgaaaatagtcattgaccccacttttgtgatgatttgcatacgtgatacattatagctgaactaatttt |
18205323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #33
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 173 - 229
Target Start/End: Original strand, 22099543 - 22099599
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgt |
229 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
22099543 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccttgt |
22099599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #34
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 277 - 340
Target Start/End: Original strand, 18830946 - 18831009
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
340 |
Q |
| |
|
|||||||||| || || |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18830946 |
gaaaatagtcactggcctcacttttgtgatgatttgcatacgtgacacattataactgaaccaa |
18831009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #35
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 277 - 344
Target Start/End: Complemental strand, 35763853 - 35763786
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||||| |||||| |||||||||||||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
35763853 |
gaaaatagtcccttaccccaattttgtgatgatttacatacgtagcacattataactgaaccaatttt |
35763786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #36
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 13064465 - 13064413
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
13064465 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
13064413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #37
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 173 - 229
Target Start/End: Complemental strand, 29380910 - 29380854
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgt |
229 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |||| |||||||||||||||||| |
|
|
| T |
29380910 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccttgt |
29380854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #38
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 32208542 - 32208594
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
32208542 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
32208594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #39
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 173 - 229
Target Start/End: Original strand, 34361803 - 34361859
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgt |
229 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |||| |||||||||||||||||| |
|
|
| T |
34361803 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccttgt |
34361859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #40
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 35415633 - 35415581
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
35415633 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
35415581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #41
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 35763647 - 35763699
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
35763647 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
35763699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #42
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 41345853 - 41345905
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
41345853 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
41345905 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #43
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 277 - 344
Target Start/End: Original strand, 46087860 - 46087925
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||||| | |||| ||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
46087860 |
gaaaatagtccctgatcccatttttgtgatgatttgcatacgtg--acattataactgaaccaatttt |
46087925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #44
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 296 - 344
Target Start/End: Complemental strand, 50822178 - 50822130
Alignment:
| Q |
296 |
acttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
50822178 |
acttttgtgatgatttgcatacgtggcacattataactgaaccaatttt |
50822130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #45
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 52017505 - 52017557
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
52017505 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
52017557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #46
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 277 - 344
Target Start/End: Original strand, 5063105 - 5063172
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||| | |||||||||||||||||||||||||| ||| ||| ||||||||||| ||||||| |
|
|
| T |
5063105 |
gaaaatagtccttgaccccacttttgtgatgatttgcatatgtggcacgttataactgaatcaatttt |
5063172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #47
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 173 - 228
Target Start/End: Original strand, 23778964 - 23779019
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttg |
228 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |||||||||||| |||| |
|
|
| T |
23778964 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcttg |
23779019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #48
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 278 - 344
Target Start/End: Complemental strand, 2180471 - 2180405
Alignment:
| Q |
278 |
aaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
|||||||||||| |||||| |||||||||||||||||||||||| |||| || |||||||| ||||| |
|
|
| T |
2180471 |
aaaatagtccctgaccccatttttgtgatgatttgcatacgtgagacatgatgactgaacctatttt |
2180405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #49
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 179 - 225
Target Start/End: Original strand, 15555509 - 15555555
Alignment:
| Q |
179 |
aatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
15555509 |
aatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
15555555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #50
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 173 - 223
Target Start/End: Original strand, 32365094 - 32365144
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagt |
223 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
32365094 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
32365144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #51
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 179 - 225
Target Start/End: Original strand, 41619905 - 41619951
Alignment:
| Q |
179 |
aatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
41619905 |
aatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
41619951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #52
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 282 - 348
Target Start/End: Complemental strand, 45505786 - 45505720
Alignment:
| Q |
282 |
tagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttatag |
348 |
Q |
| |
|
|||||||| |||||| ||||||||||||||||||||||| ||||| || |||||||| ||||||||| |
|
|
| T |
45505786 |
tagtccctgaccccatttttgtgatgatttgcatacgtggcacatgatgactgaacccattttatag |
45505720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #53
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 173 - 223
Target Start/End: Complemental strand, 45505894 - 45505844
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagt |
223 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
45505894 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
45505844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #54
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 179 - 225
Target Start/End: Complemental strand, 51545963 - 51545917
Alignment:
| Q |
179 |
aatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
51545963 |
aatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
51545917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #55
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 123534 - 123586
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
123534 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtcc |
123586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #56
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 2034855 - 2034803
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||||||||| |||||||||||||| |||||||||||||| |
|
|
| T |
2034855 |
ggctaaaatatggttttagtcccagcaaatatgcctcgttttggttttagtcc |
2034803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #57
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 2180220 - 2180272
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
2180220 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtcc |
2180272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #58
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 344
Target Start/End: Original strand, 9289266 - 9289431
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgtnnnnnnnnnnnnnnttgtttttggtccctgcaaaannnnnnnn |
272 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |||| |||||||||||||| || ||||||||||||||||||||| |
|
|
| T |
9289266 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg--gtaaaaaaaaaaattgtttttggtccctgcaaaattttttgt |
9289363 |
T |
 |
| Q |
273 |
nnnngaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||||| |||||| ||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
9289364 |
ttttgaaaatagtcccttaccccaattttgtgatgatttgcata----gcacattataactgaaccaatttt |
9289431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #59
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 13064159 - 13064211
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |||| ||||||||| |
|
|
| T |
13064159 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtcc |
13064211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #60
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 229
Target Start/End: Complemental strand, 13074125 - 13074069
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgt |
229 |
Q |
| |
|
||||| ||||||||||| |||||||||||||| ||||| |||||||||||||||||| |
|
|
| T |
13074125 |
ggctaaaatatggttttggtccctgcaaatatacctcgttttggttttagtccttgt |
13074069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #61
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 13479611 - 13479559
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |||| |||||||||||||| |
|
|
| T |
13479611 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
13479559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #62
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 13530713 - 13530661
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
13530713 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
13530661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #63
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 23245231 - 23245283
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
23245231 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
23245283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #64
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 24474963 - 24474911
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |||| |||||||||||||| |
|
|
| T |
24474963 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
24474911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #65
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 24774045 - 24774097
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
24774045 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
24774097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #66
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 27008084 - 27008136
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||| |||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
27008084 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc |
27008136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #67
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 28809180 - 28809128
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
28809180 |
ggctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagtcc |
28809128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #68
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 29499182 - 29499234
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
29499182 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
29499234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #69
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 30046792 - 30046740
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
30046792 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
30046740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #70
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 30061133 - 30061081
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
30061133 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
30061081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #71
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 32365483 - 32365431
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |||| |||||||||||||| |
|
|
| T |
32365483 |
ggctaaaatatggttttagtccctgcaaatatggctcgttttggttttagtcc |
32365431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #72
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 35464382 - 35464330
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
35464382 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
35464330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #73
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 42848391 - 42848339
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
42848391 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
42848339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #74
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 43231389 - 43231337
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
43231389 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
43231337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #75
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 45505600 - 45505652
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||| | |||||||||||||| |
|
|
| T |
45505600 |
ggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtcc |
45505652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #76
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 46088060 - 46088008
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |||| |||||||||||||| |
|
|
| T |
46088060 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
46088008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #77
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 46115414 - 46115466
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
46115414 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
46115466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #78
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 46128548 - 46128600
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
46128548 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
46128600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #79
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 50714240 - 50714292
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
50714240 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtcc |
50714292 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #80
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 229
Target Start/End: Original strand, 53716921 - 53716977
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgt |
229 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| || | |||||||||||||||||| |
|
|
| T |
53716921 |
ggctaaaatatggttttagtccctgcaaatatgtcttgttttggttttagtccttgt |
53716977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #81
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 55072389 - 55072441
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
55072389 |
ggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtcc |
55072441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #82
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 173 - 224
Target Start/End: Original strand, 6827546 - 6827597
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtc |
224 |
Q |
| |
|
||||| |||||||||||||||| ||||||||||||||| ||||||||||||| |
|
|
| T |
6827546 |
ggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtc |
6827597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #83
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 174 - 225
Target Start/End: Original strand, 11285504 - 11285555
Alignment:
| Q |
174 |
gctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
|||| |||||| ||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
11285504 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtcc |
11285555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #84
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 173 - 224
Target Start/End: Complemental strand, 22099912 - 22099861
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtc |
224 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |||| ||||||||||||| |
|
|
| T |
22099912 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
22099861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #85
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 173 - 228
Target Start/End: Complemental strand, 41346218 - 41346163
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttg |
228 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
41346218 |
ggctaaaatatggttttagtccctgcaaatatgtctcattttggttttagtccttg |
41346163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #86
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 173 - 224
Target Start/End: Complemental strand, 45474596 - 45474545
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtc |
224 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| ||| ||||||||||||| |
|
|
| T |
45474596 |
ggctaaaatatggttttagtccctgcaaatatgcttcgctttggttttagtc |
45474545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #87
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 173 - 224
Target Start/End: Complemental strand, 46292651 - 46292600
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtc |
224 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
46292651 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtc |
46292600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #88
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 173 - 224
Target Start/End: Original strand, 51545629 - 51545680
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtc |
224 |
Q |
| |
|
||||| |||||||||||||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
51545629 |
ggctaaaatatggttttagtccctgcaaatatacctcgttttggttttagtc |
51545680 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #89
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 173 - 224
Target Start/End: Original strand, 51708693 - 51708744
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtc |
224 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |||| ||||||||||||| |
|
|
| T |
51708693 |
ggctaaaatatggttttagtccctgcaaatatggctcgttttggttttagtc |
51708744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #90
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 173 - 224
Target Start/End: Complemental strand, 51709027 - 51708976
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtc |
224 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
51709027 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtc |
51708976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #91
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 179 - 225
Target Start/End: Complemental strand, 123892 - 123846
Alignment:
| Q |
179 |
aatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
123892 |
aatatggttttagtccctgcaaatatgcctcattttggttttagtcc |
123846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #92
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 179 - 225
Target Start/End: Complemental strand, 9289633 - 9289587
Alignment:
| Q |
179 |
aatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||||||||||||||||||||||||| |||| |||||||||||||| |
|
|
| T |
9289633 |
aatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
9289587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #93
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 179 - 225
Target Start/End: Original strand, 9445955 - 9446001
Alignment:
| Q |
179 |
aatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
|||||| ||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
9445955 |
aatatgattttagtccctgcaaatatgcctcgttttggttttagtcc |
9446001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #94
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 278 - 344
Target Start/End: Complemental strand, 22099809 - 22099743
Alignment:
| Q |
278 |
aaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||| || |||||| ||||||||||||||||||||||| ||||| || |||||||| ||||| |
|
|
| T |
22099809 |
aaaatagtctctgaccccatttttgtgatgatttgcatacgtggcacatgatgactgaacccatttt |
22099743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #95
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 179 - 229
Target Start/End: Complemental strand, 27008400 - 27008350
Alignment:
| Q |
179 |
aatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgt |
229 |
Q |
| |
|
||||||||||||||| |||||||||||||||| |||||||||||||| ||| |
|
|
| T |
27008400 |
aatatggttttagtctctgcaaatatgcctcgttttggttttagtccctgt |
27008350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #96
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 179 - 225
Target Start/End: Complemental strand, 29499540 - 29499494
Alignment:
| Q |
179 |
aatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
29499540 |
aatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
29499494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #97
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 278 - 344
Target Start/End: Original strand, 45593328 - 45593393
Alignment:
| Q |
278 |
aaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
|||||||||||| |||||| ||||||||||||||||||||||| ||||| || |||||||| ||||| |
|
|
| T |
45593328 |
aaaatagtccctgacccca-ttttgtgatgatttgcatacgtggcacatgatgactgaaccgatttt |
45593393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #98
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 278 - 344
Target Start/End: Complemental strand, 51545868 - 51545802
Alignment:
| Q |
278 |
aaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
|||||||||||| | |||| ||||||||||||||||||||||| ||||| || |||||||| ||||| |
|
|
| T |
51545868 |
aaaatagtccctgatcccatttttgtgatgatttgcatacgtggcacatgatgactgaaccgatttt |
51545802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #99
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 179 - 221
Target Start/End: Complemental strand, 55072706 - 55072664
Alignment:
| Q |
179 |
aatatggttttagtccctgcaaatatgcctcggtttggtttta |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
55072706 |
aatatggttttagtccctgcaaatatgcctcgttttggtttta |
55072664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #100
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 229
Target Start/End: Complemental strand, 2180572 - 2180516
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgt |
229 |
Q |
| |
|
||||| ||||| ||||||||||||||||||||| | || |||||||||||||||||| |
|
|
| T |
2180572 |
ggctaaaatatagttttagtccctgcaaatatggcacgttttggttttagtccttgt |
2180516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #101
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 4211561 - 4211613
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||||||| ||||||||| |||| |
|
|
| T |
4211561 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttggtcc |
4211613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #102
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 5827973 - 5827921
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||| |||| |||||||||||||| |
|
|
| T |
5827973 |
ggctaaaatatggttttggtccctgcaaatatgactcgttttggttttagtcc |
5827921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #103
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 5882552 - 5882603
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
5882552 |
ggctaaaatatggttttagtcc-tgcaaatatgcctcgttttggttttagtcc |
5882603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #104
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 8191391 - 8191339
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| || ||||| ||||| |
|
|
| T |
8191391 |
ggctaaaatatggttttagtccctgcaaatatgcctcgtttcggtttcagtcc |
8191339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #105
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 8760781 - 8760729
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||||||||||||| |||||||||| |||| |||||||||||||| |
|
|
| T |
8760781 |
ggctaaaatatggttttagtccttgcaaatatggctcgttttggttttagtcc |
8760729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #106
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 12791974 - 12791922
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||| |||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
12791974 |
ggctaaaatatgatttttgtccctgcaaatatgcctcgttttggttttagtcc |
12791922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #107
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 13073759 - 13073811
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||| |||| |||||||||||||| |
|
|
| T |
13073759 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
13073811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #108
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 13631228 - 13631280
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||| |||| |||||||||||||| |
|
|
| T |
13631228 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
13631280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #109
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 13631599 - 13631547
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||| |||| |||||||||||||| |
|
|
| T |
13631599 |
ggctaaaatatggttttggtccctgcaaatatgactcgttttggttttagtcc |
13631547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #110
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 14487802 - 14487854
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||||||| ||||||||| |||| |
|
|
| T |
14487802 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttggtcc |
14487854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #111
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 14791806 - 14791754
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||| |||| |||||||||||||| |
|
|
| T |
14791806 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
14791754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #112
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 179 - 223
Target Start/End: Complemental strand, 18205517 - 18205473
Alignment:
| Q |
179 |
aatatggttttagtccctgcaaatatgcctcggtttggttttagt |
223 |
Q |
| |
|
||||||||||||||||||||||||||| |||| |||||||||||| |
|
|
| T |
18205517 |
aatatggttttagtccctgcaaatatgtctcgttttggttttagt |
18205473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #113
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 25423924 - 25423976
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||| |||| |||||||||||||| |
|
|
| T |
25423924 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
25423976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #114
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 25424312 - 25424260
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||| |||| |||||||||||||| |
|
|
| T |
25424312 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
25424260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #115
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 26412584 - 26412532
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||| |||| |||||||||||||| |
|
|
| T |
26412584 |
ggctaaaatatggttttggtccctgcaaatatggctcgttttggttttagtcc |
26412532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #116
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 29420537 - 29420485
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||| |||| |||||||||||||| |
|
|
| T |
29420537 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
29420485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #117
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 32208901 - 32208849
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||||||||| ||||||||||||||||||| |||| ||||||||| |
|
|
| T |
32208901 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttgattttagtcc |
32208849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #118
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 35415299 - 35415351
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||||||||||| |||||||| ||| |||||||||||||| |
|
|
| T |
35415299 |
ggctaaaatatggttttagtccctgtaaatatgcatcgttttggttttagtcc |
35415351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #119
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 35464018 - 35464070
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||| |||| |||||||||||||| |
|
|
| T |
35464018 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
35464070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #120
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 35763955 - 35763903
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||| |||||||||||||| |||||||||| |||||||||||||| |
|
|
| T |
35763955 |
ggctaaaatatgattttagtccctgcagatatgcctcgttttggttttagtcc |
35763903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #121
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 36702000 - 36702052
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |||| |||| ||||||||| |
|
|
| T |
36702000 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtcc |
36702052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #122
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 41620256 - 41620204
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||||||||||| |||||||| ||| |||||||||||||| |
|
|
| T |
41620256 |
ggctaaaatatggttttagtccctgtaaatatgcatcgttttggttttagtcc |
41620204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #123
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 43231088 - 43231140
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||| |||| |||||||||||||| |
|
|
| T |
43231088 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
43231140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #124
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 46115779 - 46115727
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||||||||||||||||| | |||| |||||||||||||| |
|
|
| T |
46115779 |
ggctaaaatatggttttagtccctgcaaatacgtctcgttttggttttagtcc |
46115727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #125
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 46128913 - 46128861
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||||||||||||||||| | |||| |||||||||||||| |
|
|
| T |
46128913 |
ggctaaaatatggttttagtccctgcaaatacgtctcgttttggttttagtcc |
46128861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #126
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 46292392 - 46292444
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||||||| ||||||||| |||| |
|
|
| T |
46292392 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttggtcc |
46292444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #127
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 52430100 - 52430048
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |||| ||| |||||||||| |
|
|
| T |
52430100 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttagttttagtcc |
52430048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #128
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 52441763 - 52441815
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |||| |||| ||||||||| |
|
|
| T |
52441763 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtcc |
52441815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #129
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 52442092 - 52442040
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||||||||||||| |||||||||| |||| |||||||||||||| |
|
|
| T |
52442092 |
ggctaaaatatggttttagtccttgcaaatatgtctcgttttggttttagtcc |
52442040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #130
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 53915683 - 53915735
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||||||| |||| ||||||||| |
|
|
| T |
53915683 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttgattttagtcc |
53915735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #131
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 284 - 336
Target Start/End: Complemental strand, 54903367 - 54903315
Alignment:
| Q |
284 |
gtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaa |
336 |
Q |
| |
|
||||||| ||||||||||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
54903367 |
gtccctctccccacttttgtgatgatttgcaagcgtgacacataataactgaa |
54903315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #132
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 54903475 - 54903423
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||||| || |||||||||||||| |
|
|
| T |
54903475 |
ggctaaaatatggttttggtccctgcaaatatgccccgttttggttttagtcc |
54903423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #133
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 229
Target Start/End: Complemental strand, 55482468 - 55482412
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgt |
229 |
Q |
| |
|
||||| |||||| ||||||||||| ||||||||||||| |||||||||||||| ||| |
|
|
| T |
55482468 |
ggctaaaatatgattttagtccctccaaatatgcctcgttttggttttagtccctgt |
55482412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #134
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 174 - 225
Target Start/End: Complemental strand, 6353637 - 6353586
Alignment:
| Q |
174 |
gctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
|||| ||||||||||| |||||||||||||| ||||| |||||||||||||| |
|
|
| T |
6353637 |
gctaaaatatggttttggtccctgcaaatatacctcgttttggttttagtcc |
6353586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #135
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 284 - 343
Target Start/End: Original strand, 11692870 - 11692929
Alignment:
| Q |
284 |
gtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattt |
343 |
Q |
| |
|
|||||| ||||||||||||||||||||| |||||||| ||||| || |||||||| |||| |
|
|
| T |
11692870 |
gtccctgaccccacttttgtgatgattttcatacgtggcacatgatgactgaacccattt |
11692929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #136
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 174 - 221
Target Start/End: Original strand, 13479273 - 13479320
Alignment:
| Q |
174 |
gctagaatatggttttagtccctgcaaatatgcctcggtttggtttta |
221 |
Q |
| |
|
|||| ||||||||||||||||||||||||||| |||| |||||||||| |
|
|
| T |
13479273 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
13479320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #137
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 173 - 224
Target Start/End: Original strand, 20291986 - 20292037
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtc |
224 |
Q |
| |
|
||||| |||||| |||| |||||||||||||||||||| ||||||||||||| |
|
|
| T |
20291986 |
ggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtc |
20292037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #138
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 173 - 224
Target Start/End: Original strand, 22584287 - 22584338
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtc |
224 |
Q |
| |
|
||||| |||||||||||||||| |||||||||| |||| ||||||||||||| |
|
|
| T |
22584287 |
ggctaaaatatggttttagtccttgcaaatatgtctcgttttggttttagtc |
22584338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #139
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 173 - 224
Target Start/End: Original strand, 28448834 - 28448885
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtc |
224 |
Q |
| |
|
||||| |||||||||||||||| | ||||||||||||| ||||||||||||| |
|
|
| T |
28448834 |
ggctaaaatatggttttagtccttacaaatatgcctcgttttggttttagtc |
28448885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #140
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 277 - 344
Target Start/End: Complemental strand, 29420436 - 29420369
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
|||||||||| || ||||||||||||||||||| |||||||||| ||||| || | |||||| ||||| |
|
|
| T |
29420436 |
gaaaatagtctctaaccccacttttgtgatgatatgcatacgtggcacatgatgattgaacccatttt |
29420369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #141
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 174 - 225
Target Start/End: Complemental strand, 36702362 - 36702311
Alignment:
| Q |
174 |
gctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
|||| |||||||||||||| |||||| |||||||||| |||||||||||||| |
|
|
| T |
36702362 |
gctaaaatatggttttagttcctgcagatatgcctcgttttggttttagtcc |
36702311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #142
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 174 - 229
Target Start/End: Complemental strand, 47136170 - 47136115
Alignment:
| Q |
174 |
gctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgt |
229 |
Q |
| |
|
|||| ||||||||||| ||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
47136170 |
gctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccttgt |
47136115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #143
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 179 - 225
Target Start/End: Original strand, 2034545 - 2034591
Alignment:
| Q |
179 |
aatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
|||||| |||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
2034545 |
aatatgattttggtccctgcaaatatgcctcgttttggttttagtcc |
2034591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #144
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 284 - 338
Target Start/End: Complemental strand, 12791865 - 12791811
Alignment:
| Q |
284 |
gtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaacc |
338 |
Q |
| |
|
|||||| ||| |||||||||||||||||||| ||||||||||| || |||||||| |
|
|
| T |
12791865 |
gtccctgacctcacttttgtgatgatttgcacacgtgacacatgatgactgaacc |
12791811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #145
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 174 - 224
Target Start/End: Complemental strand, 15555637 - 15555587
Alignment:
| Q |
174 |
gctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtc |
224 |
Q |
| |
|
|||| ||||| ||||||||||||||||||||| |||| ||||||||||||| |
|
|
| T |
15555637 |
gctaaaatatagttttagtccctgcaaatatgtctcgttttggttttagtc |
15555587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #146
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 179 - 225
Target Start/End: Complemental strand, 19903649 - 19903603
Alignment:
| Q |
179 |
aatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||||||||| ||||||||||||||| |||| |||||||||||||| |
|
|
| T |
19903649 |
aatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
19903603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #147
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 179 - 225
Target Start/End: Original strand, 30060775 - 30060821
Alignment:
| Q |
179 |
aatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||||||||| |||||||||||||||||||| |||| ||||||||| |
|
|
| T |
30060775 |
aatatggttttggtccctgcaaatatgcctcgttttgtttttagtcc |
30060821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #148
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 278 - 344
Target Start/End: Original strand, 32365196 - 32365262
Alignment:
| Q |
278 |
aaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
|||||||||||| ||||| ||||||||||||||||||||||| ||||| || ||||||| ||||| |
|
|
| T |
32365196 |
aaaatagtccctggccccatttttgtgatgatttgcatacgtggcacatgatggctgaaccgatttt |
32365262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #149
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 179 - 225
Target Start/End: Original strand, 43368471 - 43368517
Alignment:
| Q |
179 |
aatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||||||||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
43368471 |
aatatggttttagtccctgcaaatatgtttcgttttggttttagtcc |
43368517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #150
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 173 - 223
Target Start/End: Complemental strand, 45593586 - 45593536
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagt |
223 |
Q |
| |
|
||||| ||||||||||||||| ||||||||||| |||| |||||||||||| |
|
|
| T |
45593586 |
ggctaaaatatggttttagtctctgcaaatatgtctcgttttggttttagt |
45593536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #151
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 291 - 333
Target Start/End: Original strand, 52429827 - 52429869
Alignment:
| Q |
291 |
accccacttttgtgatgatttgcatacgtgacacattataact |
333 |
Q |
| |
|
|||||| ||||||||||||||||||||||| |||||||||||| |
|
|
| T |
52429827 |
accccatttttgtgatgatttgcatacgtggcacattataact |
52429869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #152
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 278 - 344
Target Start/End: Original strand, 52441862 - 52441928
Alignment:
| Q |
278 |
aaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||| | |||||| ||||||||||||||||||||||||||| | || |||||||| ||||| |
|
|
| T |
52441862 |
aaaatagtctttgaccccatttttgtgatgatttgcatacgtgacacgtgatgactgaacccatttt |
52441928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #153
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 173 - 223
Target Start/End: Complemental strand, 53916047 - 53915997
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagt |
223 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||| |||| |||||||||||| |
|
|
| T |
53916047 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
53915997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #154
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 174 - 223
Target Start/End: Original strand, 2322094 - 2322143
Alignment:
| Q |
174 |
gctagaatatggttttagtccctgcaaatatgcctcggtttggttttagt |
223 |
Q |
| |
|
|||| ||||||||||| |||||| ||||||||||||| |||||||||||| |
|
|
| T |
2322094 |
gctaaaatatggttttggtccctacaaatatgcctcgttttggttttagt |
2322143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #155
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 284 - 337
Target Start/End: Complemental strand, 7642544 - 7642491
Alignment:
| Q |
284 |
gtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaac |
337 |
Q |
| |
|
|||||| |||||||||||||||||||||||| ||||| ||||| || ||||||| |
|
|
| T |
7642544 |
gtccctgaccccacttttgtgatgatttgcacacgtggcacatgatgactgaac |
7642491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #156
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 173 - 226
Target Start/End: Original strand, 14594206 - 14594259
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcct |
226 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||| ||| ||||||||||||||| |
|
|
| T |
14594206 |
ggctaaaatatggttttggtccctgcaaatatgtctcactttggttttagtcct |
14594259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #157
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 179 - 224
Target Start/End: Original strand, 14791505 - 14791550
Alignment:
| Q |
179 |
aatatggttttagtccctgcaaatatgcctcggtttggttttagtc |
224 |
Q |
| |
|
||||||||||| ||||||||||||||||||| ||||||||||||| |
|
|
| T |
14791505 |
aatatggttttggtccctgcaaatatgcctcattttggttttagtc |
14791550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #158
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 179 - 224
Target Start/End: Original strand, 16712335 - 16712380
Alignment:
| Q |
179 |
aatatggttttagtccctgcaaatatgcctcggtttggttttagtc |
224 |
Q |
| |
|
|||||||||||| ||||||||||||||||||| |||||| |||||| |
|
|
| T |
16712335 |
aatatggttttaatccctgcaaatatgcctcgttttggtattagtc |
16712380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #159
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 173 - 226
Target Start/End: Complemental strand, 41921084 - 41921031
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcct |
226 |
Q |
| |
|
||||| ||||||||||||| ||||||||||||| ||| ||||||||||||||| |
|
|
| T |
41921084 |
ggctaaaatatggttttagcccctgcaaatatgtttcgttttggttttagtcct |
41921031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #160
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 179 - 224
Target Start/End: Complemental strand, 54208819 - 54208774
Alignment:
| Q |
179 |
aatatggttttagtccctgcaaatatgcctcggtttggttttagtc |
224 |
Q |
| |
|
||||||||||| ||||||||||||||| |||| ||||||||||||| |
|
|
| T |
54208819 |
aatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
54208774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #161
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 4279022 - 4279074
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||||| |||||||||||| |||| |||||||||||||| |
|
|
| T |
4279022 |
ggctaaaatatggttttagcccctgcaaatatatctcgttttggttttagtcc |
4279074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #162
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 5827655 - 5827707
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||| ||| |||||||||||||| |
|
|
| T |
5827655 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtcc |
5827707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #163
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 8760604 - 8760656
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||| |||||| |||||||||||||| |||| |||||||||||||| |
|
|
| T |
8760604 |
ggctaaaatatagttttactccctgcaaatatgtctcgttttggttttagtcc |
8760656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #164
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 173 - 221
Target Start/End: Original strand, 8904886 - 8904934
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggtttta |
221 |
Q |
| |
|
||||| ||||| ||||| |||||||||||||||||||| |||||||||| |
|
|
| T |
8904886 |
ggctaaaatatagttttggtccctgcaaatatgcctcgttttggtttta |
8904934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #165
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 11693121 - 11693069
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||| |||| |||| ||||||||| |
|
|
| T |
11693121 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttgattttagtcc |
11693069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #166
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 12152493 - 12152441
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||| |||| ||||||||| |||| |
|
|
| T |
12152493 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttggtcc |
12152441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #167
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 13764613 - 13764665
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||| |||| |||||||| ||||| |
|
|
| T |
13764613 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttaagtcc |
13764665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #168
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 14488187 - 14488135
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||| ||| |||||||||||||| |
|
|
| T |
14488187 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtcc |
14488135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #169
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 19321859 - 19321807
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||| ||| |||||||||||||| |
|
|
| T |
19321859 |
ggctaaaatatggttttggtccctgcaaatatgtttcgttttggttttagtcc |
19321807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #170
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 173 - 229
Target Start/End: Complemental strand, 22584607 - 22584551
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgt |
229 |
Q |
| |
|
||||| ||| ||||||||||| |||||||||||| ||| |||||||||||||| ||| |
|
|
| T |
22584607 |
ggctaaaatgtggttttagtctctgcaaatatgcttcgttttggttttagtccctgt |
22584551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #171
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 23245595 - 23245543
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| |||||||||||||| |||| |||||||||||||| |
|
|
| T |
23245595 |
ggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtcc |
23245543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #172
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 23779225 - 23779173
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||||||||| |||||||||||||| ||| |||||||||||||| |
|
|
| T |
23779225 |
ggctaaaatatggttttaatccctgcaaatatgtctcattttggttttagtcc |
23779173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #173
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 24474600 - 24474651
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||||||||||||| ||||||||||| ||| |||||||||||||| |
|
|
| T |
24474600 |
ggctaaaatatggttttagtcc-tgcaaatatgcatcgttttggttttagtcc |
24474651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #174
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 26412190 - 26412242
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| |||||||||||||| |||| |||||||||||||| |
|
|
| T |
26412190 |
ggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtcc |
26412242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #175
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 27427872 - 27427923
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||||||| |||||||||||||||| |||| |||||||||||||| |
|
|
| T |
27427872 |
ggctaaaatatggttt-agtccctgcaaatatggctcgttttggttttagtcc |
27427923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #176
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 28809011 - 28809063
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||||||||||||| |||||||||| ||| |||||||||||||| |
|
|
| T |
28809011 |
ggctaaaatatggttttagtccttgcaaatatgtatcgttttggttttagtcc |
28809063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #177
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 29380668 - 29380720
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||| ||||||||||||||||||||| |||| ||||||||| |||| |
|
|
| T |
29380668 |
ggctaaaatatagttttagtccctgcaaatatgtctcgttttggttttggtcc |
29380720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #178
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 173 - 221
Target Start/End: Original strand, 29463610 - 29463658
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggtttta |
221 |
Q |
| |
|
||||| |||||||||||| | ||||||||||||||||| |||||||||| |
|
|
| T |
29463610 |
ggctaaaatatggttttatttcctgcaaatatgcctcgttttggtttta |
29463658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #179
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 31560331 - 31560383
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||| ||| |||||||||||||| |
|
|
| T |
31560331 |
ggctaaaatatggttttgatccctgcaaatatgcttcgttttggttttagtcc |
31560383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #180
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 31560695 - 31560643
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||| ||| |||||||||||||| |
|
|
| T |
31560695 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtcc |
31560643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #181
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 31812213 - 31812161
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| || |||||||||||| |||| |||||||||||||| |
|
|
| T |
31812213 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggttttagtcc |
31812161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #182
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 34355283 - 34355231
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||||||||||||||| ||||||| |||| |||||||||||||| |
|
|
| T |
34355283 |
ggctaaaatatggttttagtccctcaaaatatgactcgttttggttttagtcc |
34355231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #183
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 35119292 - 35119344
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||| || |||||||||||||| |
|
|
| T |
35119292 |
ggctaaaatatggttttggtccctgcaaatatgctccgttttggttttagtcc |
35119344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #184
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 36054150 - 36054098
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||| |||||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
36054150 |
ggctaaaatacggttttggtccctgcaaatatgcctcattttggttttagtcc |
36054098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #185
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 37556841 - 37556893
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||||| || ||||||||| ||||| |||||||||||||| |
|
|
| T |
37556841 |
ggctaaaatatggttttagaccttgcaaatatacctcgatttggttttagtcc |
37556893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #186
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 41324890 - 41324838
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| || |||||||||||||||| |||||||||||||| |
|
|
| T |
41324890 |
ggctaaaatatggttttgatctctgcaaatatgcctcgttttggttttagtcc |
41324838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #187
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 173 - 229
Target Start/End: Complemental strand, 42824091 - 42824035
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgt |
229 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||| || | |||| ||||||||||||| |
|
|
| T |
42824091 |
ggctaaaatatggttttggtccctgcaaatatgtcttgttttgattttagtccttgt |
42824035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #188
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 42848027 - 42848079
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| || |||||||||||| |||| |||||||||||||| |
|
|
| T |
42848027 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggttttagtcc |
42848079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #189
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 45593228 - 45593280
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||| |||||||||||| ||||||||||||| ||||| |||||||| |
|
|
| T |
45593228 |
ggctaaaatatagttttagtccctacaaatatgcctcgttttggctttagtcc |
45593280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #190
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 53308068 - 53308016
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||| | || |||||||||||||| |
|
|
| T |
53308068 |
ggctaaaatatggttttggtccctgcaaatatgtcccgttttggttttagtcc |
53308016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #191
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 179 - 225
Target Start/End: Original strand, 5202932 - 5202979
Alignment:
| Q |
179 |
aatatggttttagtccctgcaaatatgcctcg-gtttggttttagtcc |
225 |
Q |
| |
|
||||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
5202932 |
aatatggttttggtccctgcaaatatgcctcgtttttggttttagtcc |
5202979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #192
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 284 - 343
Target Start/End: Complemental strand, 5797711 - 5797652
Alignment:
| Q |
284 |
gtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattt |
343 |
Q |
| |
|
|||||| || ||||||||||||||||||||| ||||| ||||| || |||||||| |||| |
|
|
| T |
5797711 |
gtccctgactccacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt |
5797652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #193
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 284 - 343
Target Start/End: Original strand, 13530488 - 13530547
Alignment:
| Q |
284 |
gtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattt |
343 |
Q |
| |
|
|||||| || ||||||||||||||||||||| ||||| ||||| || |||||||| |||| |
|
|
| T |
13530488 |
gtccctgactccacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt |
13530547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #194
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 179 - 222
Target Start/End: Original strand, 20144426 - 20144469
Alignment:
| Q |
179 |
aatatggttttagtccctgcaaatatgcctcggtttggttttag |
222 |
Q |
| |
|
||||||||||| |||||||||||||||||||| ||| ||||||| |
|
|
| T |
20144426 |
aatatggttttggtccctgcaaatatgcctcgttttagttttag |
20144469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #195
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 284 - 343
Target Start/End: Complemental strand, 25424203 - 25424144
Alignment:
| Q |
284 |
gtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattt |
343 |
Q |
| |
|
|||||| || ||||||||||||||||||||| ||||| ||||| || |||||||| |||| |
|
|
| T |
25424203 |
gtccctgactccacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt |
25424144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #196
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 174 - 225
Target Start/End: Original strand, 36050289 - 36050340
Alignment:
| Q |
174 |
gctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
|||| ||||||||||| ||||| ||||||||| |||| |||||||||||||| |
|
|
| T |
36050289 |
gctaaaatatggttttggtccccgcaaatatgtctcgttttggttttagtcc |
36050340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #197
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 174 - 225
Target Start/End: Complemental strand, 37557194 - 37557143
Alignment:
| Q |
174 |
gctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
|||| ||||||||||| |||||||||||||| ||||| |||| ||||||||| |
|
|
| T |
37557194 |
gctaaaatatggttttggtccctgcaaatatacctcgttttgattttagtcc |
37557143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #198
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 173 - 224
Target Start/End: Original strand, 44925485 - 44925536
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtc |
224 |
Q |
| |
|
||||| ||||||||||| |||||||||||||| |||| ||||||||||||| |
|
|
| T |
44925485 |
ggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtc |
44925536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #199
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 174 - 225
Target Start/End: Complemental strand, 44925844 - 44925793
Alignment:
| Q |
174 |
gctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
|||| ||||||||||| ||| | |||||||||||||| |||||||||||||| |
|
|
| T |
44925844 |
gctaaaatatggttttggtctccgcaaatatgcctcgttttggttttagtcc |
44925793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #200
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 173 - 223
Target Start/End: Complemental strand, 2322432 - 2322382
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagt |
223 |
Q |
| |
|
||||| ||||||||||| |||||||||||||| |||| |||||||||||| |
|
|
| T |
2322432 |
ggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagt |
2322382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #201
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 284 - 326
Target Start/End: Original strand, 5827764 - 5827806
Alignment:
| Q |
284 |
gtccctcaccccacttttgtgatgatttgcatacgtgacacat |
326 |
Q |
| |
|
|||||| |||||||||||||||||||||||||| ||| ||||| |
|
|
| T |
5827764 |
gtccctgaccccacttttgtgatgatttgcatatgtggcacat |
5827806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #202
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 282 - 324
Target Start/End: Complemental strand, 14791759 - 14791717
Alignment:
| Q |
282 |
tagtccctcaccccacttttgtgatgatttgcatacgtgacac |
324 |
Q |
| |
|
|||||||| |||||||||||||||||||||||| || |||||| |
|
|
| T |
14791759 |
tagtccctgaccccacttttgtgatgatttgcacacttgacac |
14791717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #203
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 179 - 225
Target Start/End: Complemental strand, 18831172 - 18831126
Alignment:
| Q |
179 |
aatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||||||||||||||||| ||||||| || | |||||||||||||| |
|
|
| T |
18831172 |
aatatggttttagtccctgtaaatatgtcttgttttggttttagtcc |
18831126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #204
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 179 - 225
Target Start/End: Original strand, 30564839 - 30564885
Alignment:
| Q |
179 |
aatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||||||||||||||||||||||||| | | |||||||||||||| |
|
|
| T |
30564839 |
aatatggttttagtccctgcaaatatgttttgttttggttttagtcc |
30564885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #205
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 173 - 223
Target Start/End: Original strand, 31370804 - 31370854
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagt |
223 |
Q |
| |
|
||||| |||||||||||||| |||| ||||||||||| |||||||||||| |
|
|
| T |
31370804 |
ggctaaaatatggttttagtgtctgcgaatatgcctcgttttggttttagt |
31370854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #206
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 179 - 225
Target Start/End: Complemental strand, 35420697 - 35420651
Alignment:
| Q |
179 |
aatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||||||||| |||| |||||||||| |||| |||||||||||||| |
|
|
| T |
35420697 |
aatatggttttggtccttgcaaatatgtctcgatttggttttagtcc |
35420651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #207
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 173 - 223
Target Start/End: Original strand, 42823776 - 42823826
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagt |
223 |
Q |
| |
|
||||| |||||| |||| ||||||||||||||| |||| |||||||||||| |
|
|
| T |
42823776 |
ggctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagt |
42823826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #208
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 292 - 326
Target Start/End: Original strand, 46292449 - 46292483
Alignment:
| Q |
292 |
ccccacttttgtgatgatttgcatacgtgacacat |
326 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| |
|
|
| T |
46292449 |
ccccacttttgtgatgatttgcacacgtgacacat |
46292483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #209
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 179 - 225
Target Start/End: Original strand, 47022746 - 47022792
Alignment:
| Q |
179 |
aatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||||||||| |||| |||||||||| |||| |||||||||||||| |
|
|
| T |
47022746 |
aatatggttttggtccttgcaaatatgtctcgttttggttttagtcc |
47022792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #210
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 173 - 223
Target Start/End: Complemental strand, 47274230 - 47274180
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagt |
223 |
Q |
| |
|
||||| ||||| |||||||| |||||||||||| |||| |||||||||||| |
|
|
| T |
47274230 |
ggctaaaatatagttttagttcctgcaaatatgtctcgttttggttttagt |
47274180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #211
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 294 - 343
Target Start/End: Complemental strand, 5203174 - 5203125
Alignment:
| Q |
294 |
ccacttttgtgatgatttgcatacgtgacacattataactgaaccaattt |
343 |
Q |
| |
|
||||||||||||||||||||| | ||||||||| || |||||||| |||| |
|
|
| T |
5203174 |
ccacttttgtgatgatttgcacatgtgacacatgatgactgaacccattt |
5203125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #212
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 294 - 339
Target Start/End: Original strand, 19321689 - 19321734
Alignment:
| Q |
294 |
ccacttttgtgatgatttgcatacgtgacacattataactgaacca |
339 |
Q |
| |
|
||||||||||||| ||||||| ||||||||||| || ||||||||| |
|
|
| T |
19321689 |
ccacttttgtgataatttgcacacgtgacacatgatgactgaacca |
19321734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #213
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 294 - 343
Target Start/End: Complemental strand, 24774308 - 24774259
Alignment:
| Q |
294 |
ccacttttgtgatgatttgcatacgtgacacattataactgaaccaattt |
343 |
Q |
| |
|
||||||||||||||||||||| ||||| ||||| || |||||||| |||| |
|
|
| T |
24774308 |
ccacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt |
24774259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #214
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 284 - 337
Target Start/End: Complemental strand, 25358460 - 25358407
Alignment:
| Q |
284 |
gtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaac |
337 |
Q |
| |
|
|||||| |||||||||||||||||||||| | ||||| ||||| || ||||||| |
|
|
| T |
25358460 |
gtccctgaccccacttttgtgatgatttgaacacgtggcacatgatgactgaac |
25358407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #215
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 294 - 343
Target Start/End: Original strand, 31812042 - 31812091
Alignment:
| Q |
294 |
ccacttttgtgatgatttgcatacgtgacacattataactgaaccaattt |
343 |
Q |
| |
|
|||||||| |||||||||||| ||||||||||| || |||||||| |||| |
|
|
| T |
31812042 |
ccacttttatgatgatttgcacacgtgacacatgatgactgaacccattt |
31812091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #216
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 294 - 339
Target Start/End: Original strand, 47135897 - 47135942
Alignment:
| Q |
294 |
ccacttttgtgatgatttgcatacgtgacacattataactgaacca |
339 |
Q |
| |
|
||||||||||||||||||||| ||||| ||||| || ||||||||| |
|
|
| T |
47135897 |
ccacttttgtgatgatttgcacacgtggcacatgatgactgaacca |
47135942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #217
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 284 - 337
Target Start/End: Complemental strand, 50754146 - 50754094
Alignment:
| Q |
284 |
gtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaac |
337 |
Q |
| |
|
|||||| ||||||||||||||||||||| || ||||||||||| || ||||||| |
|
|
| T |
50754146 |
gtccctgaccccacttttgtgatgattt-cacacgtgacacatgatgactgaac |
50754094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #218
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 284 - 337
Target Start/End: Complemental strand, 51738362 - 51738309
Alignment:
| Q |
284 |
gtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaac |
337 |
Q |
| |
|
|||||| || ||||||||||||||||||||| ||||| ||||| || ||||||| |
|
|
| T |
51738362 |
gtccctgactccacttttgtgatgatttgcacacgtggcacatgatgactgaac |
51738309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #219
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 294 - 343
Target Start/End: Complemental strand, 51763083 - 51763034
Alignment:
| Q |
294 |
ccacttttgtgatgatttgcatacgtgacacattataactgaaccaattt |
343 |
Q |
| |
|
||||||||||||||||||||| |||||||| || || |||||||| |||| |
|
|
| T |
51763083 |
ccacttttgtgatgatttgcacacgtgacaaatgatgactgaacccattt |
51763034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #220
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 174 - 223
Target Start/End: Complemental strand, 51763201 - 51763152
Alignment:
| Q |
174 |
gctagaatatggttttagtccctgcaaatatgcctcggtttggttttagt |
223 |
Q |
| |
|
|||| ||||| ||||| ||||||||||||||||||| |||||||||||| |
|
|
| T |
51763201 |
gctaaaatatagttttggtccctgcaaatatgcctcattttggttttagt |
51763152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #221
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 294 - 343
Target Start/End: Complemental strand, 54208706 - 54208657
Alignment:
| Q |
294 |
ccacttttgtgatgatttgcatacgtgacacattataactgaaccaattt |
343 |
Q |
| |
|
||||||||||||||||||||| ||||| ||||| || |||||||| |||| |
|
|
| T |
54208706 |
ccacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt |
54208657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #222
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 173 - 229
Target Start/End: Complemental strand, 9446323 - 9446267
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgt |
229 |
Q |
| |
|
||||| |||||| |||||||||||| ||||||| |||| ||||||||| |||| ||| |
|
|
| T |
9446323 |
ggctaaaatatgattttagtccctgtaaatatgtctcgttttggttttcgtccctgt |
9446267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #223
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 11692762 - 11692814
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||| ||||||| ||||||||||||||||| || |||| ||||||||| |
|
|
| T |
11692762 |
ggctaaaatgtggttttggtccctgcaaatatgccccgttttgattttagtcc |
11692814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #224
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 12152154 - 12152206
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||| |||| || |||||||||| |
|
|
| T |
12152154 |
ggctaaaatatggttttggtccctgcaaatatgactcgtttaagttttagtcc |
12152206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #225
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 13530379 - 13530431
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| |||||||||||||| |||| |||| ||||||||| |
|
|
| T |
13530379 |
ggctaaaatatggttttgctccctgcaaatatgtctcgttttgattttagtcc |
13530431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #226
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 13764807 - 13764755
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| ||||||| ||||||| ||| |||||||||||||| |
|
|
| T |
13764807 |
ggctaaaatatggttttggtccctgtaaatatgtttcgttttggttttagtcc |
13764755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #227
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 18136113 - 18136061
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||| |||| ||||| ||||||||||||| |||||||||||||| |
|
|
| T |
18136113 |
ggctaaaatatgactttaatccctacaaatatgcctcgttttggttttagtcc |
18136061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #228
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 19321570 - 19321622
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||| |||| ||||||| ||| |||||||| |||||||||||||| |
|
|
| T |
19321570 |
ggctaaaatatgattttggtccctgtaaacatgcctcgttttggttttagtcc |
19321622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #229
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 173 - 221
Target Start/End: Complemental strand, 20144731 - 20144683
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggtttta |
221 |
Q |
| |
|
||||| ||||||||||| || | ||||||||||||||| |||||||||| |
|
|
| T |
20144731 |
ggctaaaatatggttttggttcatgcaaatatgcctcgttttggtttta |
20144683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #230
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 294 - 326
Target Start/End: Complemental strand, 20292199 - 20292167
Alignment:
| Q |
294 |
ccacttttgtgatgatttgcatacgtgacacat |
326 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| |
|
|
| T |
20292199 |
ccacttttgtgatgatttgcacacgtgacacat |
20292167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #231
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 25358540 - 25358488
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||| |||| ||||||| ||||||| |||| |||||||||||||| |
|
|
| T |
25358540 |
ggctaaaatatgattttggtccctgtaaatatgtctcgttttggttttagtcc |
25358488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #232
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 26314332 - 26314280
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| |||||| ||||||| |||| |||||||||||||| |
|
|
| T |
26314332 |
ggctaaaatatggttttgatccctgaaaatatgtctcgttttggttttagtcc |
26314280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #233
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 31182504 - 31182452
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||||||||| | |||||||||||| |||| |||||||| ||||| |
|
|
| T |
31182504 |
ggctaaaatatggttttaattcctgcaaatatgtctcgttttggtttcagtcc |
31182452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #234
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 31811925 - 31811977
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| |||||||||||||| ||| |||||||||||||| |
|
|
| T |
31811925 |
ggctaaaatatggttttgatccctgcaaatatgtatcgttttggttttagtcc |
31811977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #235
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 35119611 - 35119559
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| ||| ||||||||||| |||| |||||||| ||||| |
|
|
| T |
35119611 |
ggctaaaatatggttttggtcactgcaaatatgtctcgttttggtttcagtcc |
35119559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #236
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 179 - 223
Target Start/End: Original strand, 41920774 - 41920818
Alignment:
| Q |
179 |
aatatggttttagtccctgcaaatatgcctcggtttggttttagt |
223 |
Q |
| |
|
||||||||||||||||||||||||||| ||| |||| ||||||| |
|
|
| T |
41920774 |
aatatggttttagtccctgcaaatatgactcattttgattttagt |
41920818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #237
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 47023105 - 47023053
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| |||||||||||||| ||| |||||||||||||| |
|
|
| T |
47023105 |
ggctaaaatatggttttgatccctgcaaatatgtttcgttttggttttagtcc |
47023053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #238
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 179 - 223
Target Start/End: Complemental strand, 47532666 - 47532622
Alignment:
| Q |
179 |
aatatggttttagtccctgcaaatatgcctcggtttggttttagt |
223 |
Q |
| |
|
||||||||||| |||| |||||||||| |||| |||||||||||| |
|
|
| T |
47532666 |
aatatggttttggtccttgcaaatatgtctcgttttggttttagt |
47532622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #239
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 49123321 - 49123269
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||| |||| ||||| ||||||||||||| |||||||||||||| |
|
|
| T |
49123321 |
ggctaaaatatgactttaatccctacaaatatgcctcgttttggttttagtcc |
49123269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #240
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 173 - 221
Target Start/End: Original strand, 51738137 - 51738185
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggtttta |
221 |
Q |
| |
|
||||| ||||||||||| |||||| |||||||| |||| |||||||||| |
|
|
| T |
51738137 |
ggctaaaatatggttttggtccctacaaatatgtctcgttttggtttta |
51738185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #241
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 51738411 - 51738359
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| |||| ||||||||||||||| |||| |||| |||| |
|
|
| T |
51738411 |
ggctaaaatatggttttggtccatgcaaatatgcctcgttttgattttggtcc |
51738359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #242
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 173 - 221
Target Start/End: Original strand, 52543422 - 52543470
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggtttta |
221 |
Q |
| |
|
||||| ||||||||||| |||| |||||||||| |||| |||||||||| |
|
|
| T |
52543422 |
ggctaaaatatggttttggtccttgcaaatatgtctcgttttggtttta |
52543470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #243
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 189 - 225
Target Start/End: Original strand, 54208477 - 54208513
Alignment:
| Q |
189 |
tagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |
|
|
| T |
54208477 |
tagtccctgcaaatatgcctcattttggttttagtcc |
54208513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 65; Significance: 2e-28; HSPs: 253)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 173 - 344
Target Start/End: Original strand, 29445954 - 29446123
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgtnnnnnnnnnnnnnnttgtttttggtccctgcaaaannnnnnnn |
272 |
Q |
| |
|
||||| |||||| ||||||||||||||||||||||||| |||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
29445954 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgtaacaaaaaaaat--ttgtttttggtccctgcaaaattttttgt |
29446051 |
T |
 |
| Q |
273 |
nnnngaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29446052 |
tttttaaaatagtccctaaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
29446123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 64; E-Value: 9e-28
Query Start/End: Original strand, 277 - 344
Target Start/End: Original strand, 275543 - 275610
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
275543 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
275610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 64; E-Value: 9e-28
Query Start/End: Original strand, 277 - 348
Target Start/End: Complemental strand, 12673904 - 12673833
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttatag |
348 |
Q |
| |
|
|||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12673904 |
gaaaatagtctctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttatag |
12673833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 64; E-Value: 9e-28
Query Start/End: Original strand, 277 - 344
Target Start/End: Complemental strand, 20907356 - 20907289
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20907356 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
20907289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 64; E-Value: 9e-28
Query Start/End: Original strand, 277 - 344
Target Start/End: Complemental strand, 39288798 - 39288731
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39288798 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
39288731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 173 - 344
Target Start/End: Complemental strand, 3152111 - 3151943
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgtnnnnnnnnnnnnnnttgtttttggtccctgcaaaannnnnnnn |
272 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |||||||||||||| || ||||||||||||||||||||| |
|
|
| T |
3152111 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg---gtaaaaaaaaatttgtttttggtccctgcaaaattttttgt |
3152015 |
T |
 |
| Q |
273 |
nnnngaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
|||||||||| || |||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
3152014 |
ttttgaaaatagtctctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaatttt |
3151943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 173 - 344
Target Start/End: Original strand, 26799888 - 26800057
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgtnnnnnnnnnnnnnnttgtttttggtccctgcaaaannnnnnnn |
272 |
Q |
| |
|
||||| ||||||||||||||||||| |||||||||||| |||||||||||||| || ||||||||||||||||||||| |
|
|
| T |
26799888 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg--gtaaaaaaaaaaattgtttttggtccctgcaaaattttttgt |
26799985 |
T |
 |
| Q |
273 |
nnnngaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26799986 |
ttttgaaaatagtccttgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
26800057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 173 - 344
Target Start/End: Complemental strand, 39437109 - 39436940
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgtnnnnnnnnnnnnnnttgtttttggtccctgcaaaannnnnnnn |
272 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |||||||||||||| || ||||||||||||||||||||| |
|
|
| T |
39437109 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg--gtaaaaaaaaaatttgtttttggtccctgcaaaattttttgt |
39437012 |
T |
 |
| Q |
273 |
nnnngaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||| ||| ||||||||||||||||||||||| |
|
|
| T |
39437011 |
ttttgaaaatagtccctgaccccacttttgtgatgatttgcatatgtggcacattataactgaaccaatttt |
39436940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 61; E-Value: 6e-26
Query Start/End: Original strand, 173 - 344
Target Start/End: Complemental strand, 21159817 - 21159648
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgtnnnnnnnnnnnnnnttgtttttggtccctgcaaaannnnnnnn |
272 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |||||||||||| | ||| ||||||||||||||||||||| |
|
|
| T |
21159817 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctgtaaaaagaaaatt--ttgtttttggtccctgcaaaattttttgt |
21159720 |
T |
 |
| Q |
273 |
nnnngaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||||| || ||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
21159719 |
ttttgaaaatagtccctgacaccacttttgtgatgatttgcatacgtggcacattataactgaaccaatttt |
21159648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 61; E-Value: 6e-26
Query Start/End: Original strand, 173 - 344
Target Start/End: Complemental strand, 45320979 - 45320812
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgtnnnnnnnnnnnnnnttgtttttggtccctgcaaaannnnnnnn |
272 |
Q |
| |
|
||||| |||||| ||||||||||||||||||||||||| |||||||||||||| ||| ||||||||| ||||||||||| |
|
|
| T |
45320979 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaat----ttgtttttgatccctgcaaaattttttgt |
45320884 |
T |
 |
| Q |
273 |
nnnngaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
45320883 |
ttttgaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataattgaaccaatttt |
45320812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 277 - 344
Target Start/End: Original strand, 13584105 - 13584172
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
13584105 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaatttt |
13584172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 277 - 344
Target Start/End: Original strand, 16123242 - 16123309
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
|||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16123242 |
gaaaatagtctctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
16123309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 277 - 344
Target Start/End: Complemental strand, 19656802 - 19656735
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
19656802 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaatttt |
19656735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 277 - 344
Target Start/End: Original strand, 22156031 - 22156098
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
22156031 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaatttt |
22156098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 277 - 344
Target Start/End: Original strand, 30004554 - 30004621
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
30004554 |
gaaaatagtccctgaccccacttttgtgatgatttgcatgcgtgacacattataactgaaccaatttt |
30004621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 277 - 344
Target Start/End: Original strand, 37506968 - 37507035
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
37506968 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaatttt |
37507035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 277 - 344
Target Start/End: Original strand, 45161213 - 45161280
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45161213 |
gaaaatagtccctgacaccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
45161280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 173 - 344
Target Start/End: Original strand, 8510214 - 8510383
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgtnnnnnnnnnnnnnnttgtttttggtccctgcaaaannnnnnnn |
272 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||| |||||||||||||| || ||||||||||||||||||||| |
|
|
| T |
8510214 |
ggctaaaatatggttttagtccctgcaaatatgcctctttttggttttagtccctg--gtaaaaaaaaaatttgtttttggtccctgcaaaattttttgt |
8510311 |
T |
 |
| Q |
273 |
nnnngaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
|||||||||| || |||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
8510312 |
ttttgaaaatagtctctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaatttt |
8510383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 173 - 344
Target Start/End: Original strand, 10976978 - 10977146
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgtnnnnnnnnnnnnnnttgtttttggtccctgcaaaannnnnnnn |
272 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |||||||||||||| || |||||| |||||||||||||| |
|
|
| T |
10976978 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg---gtaaaaaaaaaattgtttctggtccctgcaaaattttttgt |
10977074 |
T |
 |
| Q |
273 |
nnnngaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
10977075 |
ttttgaaaatagtccctgaccccacttttgtgatgatttgcatacgtggtacattataactgaaccaatttt |
10977146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 173 - 344
Target Start/End: Complemental strand, 28427608 - 28427440
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgtnnnnnnnnnnnnnnttgtttttggtccctgcaaaannnnnnnn |
272 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |||||||||||||| || ||||||||||||||||||||| |
|
|
| T |
28427608 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg---gtaaaaaaaaaattgtttttggtccctgcaaaattttttgt |
28427512 |
T |
 |
| Q |
273 |
nnnngaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
|||||||||| || ||||||||||||||||||||||||||| || ||||||||||||||||||||||| |
|
|
| T |
28427511 |
ttttgaaaatagtctctgaccccacttttgtgatgatttgcatacatggcacattataactgaaccaatttt |
28427440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 173 - 344
Target Start/End: Original strand, 34238598 - 34238766
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgtnnnnnnnnnnnnnnttgtttttggtccctgcaaaannnnnnnn |
272 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |||| ||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
34238598 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccttg---gtaaaaaaaaaattgtttttggtccctgcaaaattttttgt |
34238694 |
T |
 |
| Q |
273 |
nnnngaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||||| || ||||||||| ||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
34238695 |
ttttgaaaatagtccctgactccacttttgagatgatttgcatacgtggcacattataactgaaccaatttt |
34238766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 173 - 344
Target Start/End: Complemental strand, 51834942 - 51834774
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgtnnnnnnnnnnnnnnttgtttttggtccctgcaaaannnnnnnn |
272 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| ||| |||||||||||||| || ||||||||||||||||||||| |
|
|
| T |
51834942 |
ggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctg---gtaaaaaaaaaattgtttttggtccctgcaaaactttttgt |
51834846 |
T |
 |
| Q |
273 |
nnnngaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||||| |||||||| ||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
51834845 |
ttttgaaaatagtccctgaccccactattgtgatgatttgcatacgtgacacattataacggaaccaatttt |
51834774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 277 - 344
Target Start/End: Complemental strand, 4950266 - 4950199
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
|||||||| |||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
4950266 |
gaaaataggccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaatttt |
4950199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 277 - 344
Target Start/End: Complemental strand, 14633786 - 14633719
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||||| ||||||||||||||| |||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
14633786 |
gaaaatagtccctaaccccacttttgtgaagatttgcatacgtggcacattataactgaaccaatttt |
14633719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #25
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 277 - 344
Target Start/End: Original strand, 20757500 - 20757567
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||||| |||||||||||||||| ||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
20757500 |
gaaaatagtccctgaccccacttttgtgattatttgcatacgtggcacattataactgaaccaatttt |
20757567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #26
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 277 - 344
Target Start/End: Original strand, 29955400 - 29955467
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
29955400 |
gaaaatagtccctgaccccacttttgtgatgatttgcattcgtgtcacattataactgaaccaatttt |
29955467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #27
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 277 - 344
Target Start/End: Complemental strand, 39072112 - 39072045
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||||| |||||||||||||||| ||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
39072112 |
gaaaatagtccctgaccccacttttgtgataatttgcatacgtggcacattataactgaaccaatttt |
39072045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #28
Raw Score: 54; E-Value: 8e-22
Query Start/End: Original strand, 278 - 343
Target Start/End: Complemental strand, 5345587 - 5345522
Alignment:
| Q |
278 |
aaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattt |
343 |
Q |
| |
|
|||||||||||| | |||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
5345587 |
aaaatagtccctgatcccacttttgtgatgatttgcatacgtggcacattataactgaaccaattt |
5345522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #29
Raw Score: 54; E-Value: 8e-22
Query Start/End: Original strand, 279 - 344
Target Start/End: Complemental strand, 20612796 - 20612731
Alignment:
| Q |
279 |
aaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
|||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
20612796 |
aaatagcccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacaaatttt |
20612731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #30
Raw Score: 54; E-Value: 8e-22
Query Start/End: Original strand, 291 - 344
Target Start/End: Complemental strand, 49670723 - 49670670
Alignment:
| Q |
291 |
accccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49670723 |
accccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
49670670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #31
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 173 - 344
Target Start/End: Original strand, 30130158 - 30130325
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgtnnnnnnnnnnnnnnttgtttttggtccctgcaaaannnnnnnn |
272 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |||| |||||||||||| | ||| ||||||||||||||||||||| |
|
|
| T |
30130158 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctgtaaaaaaaaaa----ttgtttttggtccctgcaaaattttttgt |
30130253 |
T |
 |
| Q |
273 |
nnnngaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
|||||||||| || ||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
30130254 |
ttttgaaaatagtctctggccccacttttgtgatgatttgcatacgtgacacattatagctgaaccaatttt |
30130325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #32
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 277 - 344
Target Start/End: Complemental strand, 7518346 - 7518279
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
|||||||||| || ||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
7518346 |
gaaaatagtctctggccccacttttgtgatgatttgcatacgtgacacattataactgaaacaatttt |
7518279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #33
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 277 - 344
Target Start/End: Complemental strand, 10778631 - 10778564
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||||||||| ||| ||||||||||||||||||||||| |
|
|
| T |
10778631 |
gaaaatagtccctgaccctacttttgtgatgatttgcatatgtggcacattataactgaaccaatttt |
10778564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #34
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 277 - 344
Target Start/End: Complemental strand, 40169552 - 40169485
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| ||||||||| ||||||||||||||| ||||||| |
|
|
| T |
40169552 |
gaaaatagtccctgaccccacttttgtgatgattcgcatacgtggcacattataactgaatcaatttt |
40169485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #35
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 277 - 339
Target Start/End: Original strand, 47901901 - 47901963
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaacca |
339 |
Q |
| |
|
||||||||||||| || ||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
47901901 |
gaaaatagtccctgactccacttttgtgatgatttgcatacgtggcacattataactgaacca |
47901963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #36
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 173 - 229
Target Start/End: Complemental strand, 3830516 - 3830460
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgt |
229 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
3830516 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccttgt |
3830460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #37
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 277 - 344
Target Start/End: Complemental strand, 9863303 - 9863235
Alignment:
| Q |
277 |
gaaaatagtccctcaccccactttt-gtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||||| || |||||||| |||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
9863303 |
gaaaatagtccctgacaccactttttgtgatgatttgcatacgtgacacattataattgaaccaatttt |
9863235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #38
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 173 - 348
Target Start/End: Complemental strand, 31869956 - 31869785
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgtnnnnnnnnnnnnnnttgtttttggtccctgcaaaannnnnnnn |
272 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |||| ||| |||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
31869956 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttagttttagtccctgtaaaaaaaaaa----ttgtttttggtccctgcaaaactttttgt |
31869861 |
T |
 |
| Q |
273 |
nnnngaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttatag |
348 |
Q |
| |
|
||||||||||| | || |||||||||||||||| || ||||||| ||||||||||||||||||||||||||| |
|
|
| T |
31869860 |
ttttgaaaatagtccatgactccacttttgtgatgatctgtatacgtggcacattataactgaaccaattttatag |
31869785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #39
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 278 - 344
Target Start/End: Original strand, 18175889 - 18175955
Alignment:
| Q |
278 |
aaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
|||||||||||| ||| | ||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
18175889 |
aaaatagtccctgaccttatttttgtgatgatttgcatacgtggcacattataactgaaccaatttt |
18175955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #40
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 278 - 348
Target Start/End: Original strand, 30268585 - 30268655
Alignment:
| Q |
278 |
aaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttatag |
348 |
Q |
| |
|
|||||||| ||| |||||| ||||||||||||||||||||||||||||| || |||||||| ||||||||| |
|
|
| T |
30268585 |
aaaatagttcctgaccccatttttgtgatgatttgcatacgtgacacatgatgactgaaccgattttatag |
30268655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #41
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 3151750 - 3151802
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
3151750 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
3151802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #42
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 4513263 - 4513315
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
4513263 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
4513315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #43
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 4950037 - 4950089
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
4950037 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
4950089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #44
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 20612898 - 20612846
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
20612898 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
20612846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #45
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 25710870 - 25710818
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
25710870 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
25710818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #46
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 37506867 - 37506919
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
37506867 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
37506919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #47
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 37507222 - 37507170
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
37507222 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
37507170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #48
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 173 - 229
Target Start/End: Original strand, 46751271 - 46751327
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgt |
229 |
Q |
| |
|
||||| |||||||||||| ||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
46751271 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtccttgt |
46751327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #49
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 51834608 - 51834660
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
51834608 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
51834660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #50
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 174 - 225
Target Start/End: Complemental strand, 22156292 - 22156241
Alignment:
| Q |
174 |
gctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
22156292 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
22156241 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #51
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 277 - 344
Target Start/End: Complemental strand, 25710771 - 25710704
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
|||||||||| || || |||||||||||||||| || ||||||| ||||||||||||||||||||||| |
|
|
| T |
25710771 |
gaaaatagtctctgactccacttttgtgatgatctgtatacgtggcacattataactgaaccaatttt |
25710704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #52
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 277 - 344
Target Start/End: Original strand, 45521650 - 45521717
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
|||||||||| || | |||| |||| ||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
45521650 |
gaaaatagtcacttatcccatttttttgatgatttgcatacgtgacacattataactgaaccagtttt |
45521717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #53
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 278 - 344
Target Start/End: Complemental strand, 4513519 - 4513453
Alignment:
| Q |
278 |
aaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
|||||||||||| |||||| ||||||||||||||||||||||| ||||| || |||||||| ||||| |
|
|
| T |
4513519 |
aaaatagtccctgaccccatttttgtgatgatttgcatacgtggcacatgatgactgaaccgatttt |
4513453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #54
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 286 - 344
Target Start/End: Complemental strand, 30426175 - 30426117
Alignment:
| Q |
286 |
ccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
|||| |||||| ||||||||||||||||||| |||||||||||||||| |||||||||| |
|
|
| T |
30426175 |
ccctgaccccatttttgtgatgatttgcatatgtgacacattataactaaaccaatttt |
30426117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #55
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 179 - 225
Target Start/End: Original strand, 50196305 - 50196351
Alignment:
| Q |
179 |
aatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
50196305 |
aatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
50196351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #56
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 278 - 344
Target Start/End: Complemental strand, 51500584 - 51500518
Alignment:
| Q |
278 |
aaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
|||||||||||| |||||| ||||||||||||||||||||||||||||| || |||| ||| ||||| |
|
|
| T |
51500584 |
aaaatagtccctgaccccatttttgtgatgatttgcatacgtgacacatgatgactggacccatttt |
51500518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #57
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 173 - 337
Target Start/End: Original strand, 3830134 - 3830292
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgtnnnnnnnnnnnnnnttgtttttggtccctgcaaaannnnnnnn |
272 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||| |||||||||||||| ||| ||||||||||||| ||||||| |
|
|
| T |
3830134 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgt------aaaaaaaattgtttttggtccttgcaaaattttttgt |
3830227 |
T |
 |
| Q |
273 |
nnnngaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaac |
337 |
Q |
| |
|
||||||||||||| |||||| ||||||||||||||||||||||| ||||| || ||||||| |
|
|
| T |
3830228 |
ttttgaaaatagtccctgaccccatttttgtgatgatttgcatacgtggcacatgatgactgaac |
3830292 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #58
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 295 - 344
Target Start/End: Original strand, 40979479 - 40979528
Alignment:
| Q |
295 |
cacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||| |||||| |
|
|
| T |
40979479 |
cacttttgtgatgatttgcatacgtgtcacattataactgaactaatttt |
40979528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #59
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 229
Target Start/End: Complemental strand, 5345689 - 5345633
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgt |
229 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| ||| |||||||||||||| ||| |
|
|
| T |
5345689 |
ggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctgt |
5345633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #60
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 229
Target Start/End: Original strand, 7518090 - 7518146
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgt |
229 |
Q |
| |
|
||||| |||||||| ||||||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
7518090 |
ggctaaaatatggtgttagtccctgcaaatatgcctcgtttttgttttagtccttgt |
7518146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #61
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 9262155 - 9262103
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
9262155 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
9262103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #62
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 229
Target Start/End: Complemental strand, 9863404 - 9863348
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgt |
229 |
Q |
| |
|
||||| ||||||||||||||| |||||||||||||||| |||||||||||||| ||| |
|
|
| T |
9863404 |
ggctaaaatatggttttagtctctgcaaatatgcctcgttttggttttagtccctgt |
9863348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #63
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 13584367 - 13584315
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||| | |||||||||||||| |
|
|
| T |
13584367 |
ggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtcc |
13584315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #64
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 15016388 - 15016440
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||| | |||||||||||||| |
|
|
| T |
15016388 |
ggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtcc |
15016440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #65
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 16123139 - 16123191
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||||||||||| |||||||||||| |||||||||||||| |
|
|
| T |
16123139 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtcc |
16123191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #66
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 229
Target Start/End: Original strand, 19656541 - 19656597
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgt |
229 |
Q |
| |
|
||||| |||||||||||||||| ||||||||||||||| |||| ||||||||||||| |
|
|
| T |
19656541 |
ggctaaaatatggttttagtccatgcaaatatgcctcgttttgattttagtccttgt |
19656597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #67
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 229
Target Start/End: Original strand, 21159453 - 21159509
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgt |
229 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |||| |||| ||||||||||||| |
|
|
| T |
21159453 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccttgt |
21159509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #68
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 22008526 - 22008578
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |||| |||||||||||||| |
|
|
| T |
22008526 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
22008578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #69
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 22008890 - 22008838
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
22008890 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
22008838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #70
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 22016044 - 22016096
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |||| |||||||||||||| |
|
|
| T |
22016044 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
22016096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #71
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 25615975 - 25616027
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
25615975 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
25616027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #72
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 28552383 - 28552331
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
28552383 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
28552331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #73
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 28942905 - 28942853
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||||||||||| ||||||||||||||||| |||||||||||||| |
|
|
| T |
28942905 |
ggctaaaatatggttttagttcctgcaaatatgcctcgttttggttttagtcc |
28942853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #74
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 229
Target Start/End: Complemental strand, 29446206 - 29446150
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgt |
229 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| || | |||||||||||||||||| |
|
|
| T |
29446206 |
ggctaaaatatggttttagtccctgcaaatatgtcttgttttggttttagtccttgt |
29446150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #75
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 179 - 223
Target Start/End: Complemental strand, 29955660 - 29955616
Alignment:
| Q |
179 |
aatatggttttagtccctgcaaatatgcctcggtttggttttagt |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
29955660 |
aatatggttttagtccctgcaaatatgcctcgttttggttttagt |
29955616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #76
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 179 - 223
Target Start/End: Complemental strand, 30004815 - 30004771
Alignment:
| Q |
179 |
aatatggttttagtccctgcaaatatgcctcggtttggttttagt |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
30004815 |
aatatggttttagtccctgcaaatatgcctcgttttggttttagt |
30004771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #77
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 30268505 - 30268557
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||| ||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
30268505 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtcc |
30268557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #78
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 31480136 - 31480188
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
31480136 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
31480188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #79
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 39288898 - 39288846
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||||||||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
39288898 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtcc |
39288846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #80
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 39436718 - 39436770
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |||| |||||||||||||| |
|
|
| T |
39436718 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
39436770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #81
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 40370589 - 40370537
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
40370589 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
40370537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #82
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 229
Target Start/End: Complemental strand, 47005519 - 47005463
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgt |
229 |
Q |
| |
|
||||| ||||||||||| |||||||||||||| ||||| |||||||||||||||||| |
|
|
| T |
47005519 |
ggctaaaatatggttttggtccctgcaaatattcctcgttttggttttagtccttgt |
47005463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #83
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 49323782 - 49323834
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
49323782 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
49323834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #84
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 51500685 - 51500633
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||| |||||||||||||||||||||| |||||||||||||| |
|
|
| T |
51500685 |
ggctaaaatatggttctagtccctgcaaatatgcctcgttttggttttagtcc |
51500633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #85
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 51550082 - 51550134
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
51550082 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
51550134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #86
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 53701663 - 53701611
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |||| |||||||||||||| |
|
|
| T |
53701663 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
53701611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #87
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 54608518 - 54608570
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
54608518 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
54608570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #88
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 284 - 343
Target Start/End: Complemental strand, 7957118 - 7957059
Alignment:
| Q |
284 |
gtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattt |
343 |
Q |
| |
|
|||||| |||||||||||||||||||||||| ||||| ||||| || ||||||||||||| |
|
|
| T |
7957118 |
gtccctgaccccacttttgtgatgatttgcacacgtggcacatgatgactgaaccaattt |
7957059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #89
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 179 - 222
Target Start/End: Original strand, 14633551 - 14633594
Alignment:
| Q |
179 |
aatatggttttagtccctgcaaatatgcctcggtttggttttag |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
14633551 |
aatatggttttagtccctgcaaatatgcctcgttttggttttag |
14633594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #90
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 173 - 224
Target Start/End: Original strand, 20611020 - 20611071
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtc |
224 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| ||| ||||||||||||| |
|
|
| T |
20611020 |
ggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtc |
20611071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #91
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 174 - 229
Target Start/End: Complemental strand, 25610129 - 25610074
Alignment:
| Q |
174 |
gctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgt |
229 |
Q |
| |
|
|||| ||||||||||| |||||||||||||||||||| |||| ||||||||||||| |
|
|
| T |
25610129 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttgattttagtccttgt |
25610074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #92
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 173 - 228
Target Start/End: Complemental strand, 34238915 - 34238860
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttg |
228 |
Q |
| |
|
||||| ||||||||||||||||| |||||||||| ||| ||||||||||||||||| |
|
|
| T |
34238915 |
ggctaaaatatggttttagtccccgcaaatatgcttcgttttggttttagtccttg |
34238860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #93
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 173 - 224
Target Start/End: Original strand, 39288573 - 39288624
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtc |
224 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |||| ||||||||||||| |
|
|
| T |
39288573 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
39288624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #94
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 174 - 229
Target Start/End: Original strand, 46186410 - 46186465
Alignment:
| Q |
174 |
gctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgt |
229 |
Q |
| |
|
|||| |||||| ||||||||||||||||||||||||| |||| ||||||||||||| |
|
|
| T |
46186410 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttgattttagtccttgt |
46186465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #95
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 277 - 344
Target Start/End: Complemental strand, 46186669 - 46186602
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||||| |||||| ||||||||||||||||||||||| ||||| || | |||||| ||||| |
|
|
| T |
46186669 |
gaaaatagtccctgaccccatttttgtgatgatttgcatacgtggcacatgatgattgaacccatttt |
46186602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #96
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 173 - 224
Target Start/End: Complemental strand, 46186771 - 46186720
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtc |
224 |
Q |
| |
|
||||| |||||||||||||||| ||||||||||||||| ||||||||||||| |
|
|
| T |
46186771 |
ggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtc |
46186720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #97
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 277 - 344
Target Start/End: Complemental strand, 50261839 - 50261773
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
|||||||||| || || |||||||||||||||||||||| | || ||||||||||||||||||||||| |
|
|
| T |
50261839 |
gaaaatagtctctgactccacttttgtgatgatttgcatgc-tggcacattataactgaaccaatttt |
50261773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #98
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 174 - 224
Target Start/End: Complemental strand, 3361817 - 3361767
Alignment:
| Q |
174 |
gctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtc |
224 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| | ||||||||||||| |
|
|
| T |
3361817 |
gctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtc |
3361767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #99
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 179 - 225
Target Start/End: Complemental strand, 8940519 - 8940473
Alignment:
| Q |
179 |
aatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
8940519 |
aatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
8940473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #100
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 278 - 344
Target Start/End: Complemental strand, 15016645 - 15016579
Alignment:
| Q |
278 |
aaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
|||||||||||| |||||| ||||||||||||||||||||||| ||||| || | |||||| ||||| |
|
|
| T |
15016645 |
aaaatagtccctgaccccatttttgtgatgatttgcatacgtggcacatgatgattgaacccatttt |
15016579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #101
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 179 - 225
Target Start/End: Original strand, 20757406 - 20757452
Alignment:
| Q |
179 |
aatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
|||||| ||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
20757406 |
aatatgattttagtccctgcaaatatgcctcgttttggttttagtcc |
20757452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #102
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 173 - 215
Target Start/End: Original strand, 25353199 - 25353241
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttg |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
25353199 |
ggctagaatatggttttagtccctgcaaatatgcctcgttttg |
25353241 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #103
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 173 - 223
Target Start/End: Original strand, 28942525 - 28942575
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagt |
223 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||| | |||||||||||| |
|
|
| T |
28942525 |
ggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagt |
28942575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #104
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 179 - 225
Target Start/End: Original strand, 29955304 - 29955350
Alignment:
| Q |
179 |
aatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||| ||||||||| |
|
|
| T |
29955304 |
aatatggttttagtccctgcaaatatgcctcgttttgattttagtcc |
29955350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #105
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 179 - 225
Target Start/End: Original strand, 30004458 - 30004504
Alignment:
| Q |
179 |
aatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||| ||||||||| |
|
|
| T |
30004458 |
aatatggttttagtccctgcaaatatgcctcgttttgattttagtcc |
30004504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #106
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 173 - 223
Target Start/End: Original strand, 44802282 - 44802332
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagt |
223 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| ||| |||||||||||| |
|
|
| T |
44802282 |
ggctaaaatatggttttagtccctgcaaatatgcgtcgttttggttttagt |
44802332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #107
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 173 - 223
Target Start/End: Original strand, 45002021 - 45002071
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagt |
223 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||||||| |||||||||||| |
|
|
| T |
45002021 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagt |
45002071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #108
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 278 - 344
Target Start/End: Original strand, 51759922 - 51759988
Alignment:
| Q |
278 |
aaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
|||||||||||| |||||| ||||||||||||||||||||||| ||||| || |||| ||| ||||| |
|
|
| T |
51759922 |
aaaatagtccctgaccccatttttgtgatgatttgcatacgtggcacatgatgactggacccatttt |
51759988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #109
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 278 - 344
Target Start/End: Original strand, 53701461 - 53701527
Alignment:
| Q |
278 |
aaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
|||||| || || |||||| ||||||||||||||||||||||| ||||| || |||||||||||||| |
|
|
| T |
53701461 |
aaaataatctctaaccccatttttgtgatgatttgcatacgtggcacatgatgactgaaccaatttt |
53701527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #110
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 294 - 343
Target Start/End: Complemental strand, 20405104 - 20405055
Alignment:
| Q |
294 |
ccacttttgtgatgatttgcatacgtgacacattataactgaaccaattt |
343 |
Q |
| |
|
||||||||||||||||||||||||||||||||| || |||||||| |||| |
|
|
| T |
20405104 |
ccacttttgtgatgatttgcatacgtgacacatgatgactgaacccattt |
20405055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #111
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 173 - 226
Target Start/End: Original strand, 29525105 - 29525158
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcct |
226 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |||| ||| ||||||||||| |
|
|
| T |
29525105 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttagttttagtcct |
29525158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #112
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 275444 - 275496
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||||||||||||||||||| ||||||||| |||| ||||||||| |
|
|
| T |
275444 |
ggctaaaatatggttttagtccctgcaactatgcctcgttttgattttagtcc |
275496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #113
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 474044 - 474096
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||| |||| |||||||||||||| |
|
|
| T |
474044 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
474096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #114
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 1721452 - 1721400
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||| ||| |||||||||||||| |
|
|
| T |
1721452 |
ggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtcc |
1721400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #115
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 3387604 - 3387552
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| ||| |||||||||||||||| |||||||||||||| |
|
|
| T |
3387604 |
ggctaaaatatggttttggtcgctgcaaatatgcctcgttttggttttagtcc |
3387552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #116
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 4034717 - 4034769
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||| |||| |||||||||||||| |
|
|
| T |
4034717 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
4034769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #117
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 229
Target Start/End: Complemental strand, 4513620 - 4513564
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgt |
229 |
Q |
| |
|
||||| |||||||||||| |||||||||||||| |||| |||||||||||||| ||| |
|
|
| T |
4513620 |
ggctaaaatatggttttactccctgcaaatatgtctcgttttggttttagtccctgt |
4513564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #118
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 221
Target Start/End: Original strand, 4814540 - 4814588
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggtttta |
221 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |||| |||||||||| |
|
|
| T |
4814540 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
4814588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #119
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 9261789 - 9261841
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||| |||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
9261789 |
ggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtcc |
9261841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #120
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 9603629 - 9603681
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
9603629 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
9603681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #121
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 10977341 - 10977289
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||| |||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
10977341 |
ggctaaaatatggatttaatccctgcaaatatgcctcgttttggttttagtcc |
10977289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #122
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 12673644 - 12673696
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||| ||||||||||||| |||||||||||| |||||||||||||| |
|
|
| T |
12673644 |
ggctaaaatatagttttagtccctgtaaatatgcctcgttttggttttagtcc |
12673696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #123
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 12740907 - 12740959
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||| |||| |||||||||||||| |
|
|
| T |
12740907 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
12740959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #124
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 12741271 - 12741219
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||| |||| |||||||||||||| |
|
|
| T |
12741271 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
12741219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #125
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 14772211 - 14772263
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||| ||| |||||||||||||| |
|
|
| T |
14772211 |
ggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtcc |
14772263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #126
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 229
Target Start/End: Original strand, 15286156 - 15286212
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgt |
229 |
Q |
| |
|
||||| |||||||||||| ||||||||||||||| ||| ||||||||||||| |||| |
|
|
| T |
15286156 |
ggctaaaatatggttttaatccctgcaaatatgcttcgttttggttttagtctttgt |
15286212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #127
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 15979338 - 15979390
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||| ||| |||||||||||||| |
|
|
| T |
15979338 |
ggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtcc |
15979390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #128
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 19844581 - 19844529
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
19844581 |
ggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtcc |
19844529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #129
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 22155929 - 22155981
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |||| |||| ||||||||| |
|
|
| T |
22155929 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtcc |
22155981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #130
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 26089730 - 26089782
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||| ||| |||||||||||||| |
|
|
| T |
26089730 |
ggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtcc |
26089782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #131
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 26090078 - 26090026
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||| |||| |||||||||||||| |
|
|
| T |
26090078 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
26090026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #132
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 28427245 - 28427297
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||||||||||| |||||||||||| |||| |||||||||||||| |
|
|
| T |
28427245 |
ggctaaaatatggttttagttcctgcaaatatgtctcgttttggttttagtcc |
28427297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #133
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 28552021 - 28552073
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||||||| ||| |||||||||| |
|
|
| T |
28552021 |
ggctaaaatatggttttggtccctgcaaatatgcctcgtttttgttttagtcc |
28552073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #134
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 30106220 - 30106168
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| |||||||||||||| ||||| |||||||||||||| |
|
|
| T |
30106220 |
ggctaaaatatggttttggtccctgcaaatatacctcgttttggttttagtcc |
30106168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #135
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 31480500 - 31480448
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||| ||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
31480500 |
ggctaaaatatggatttggtccctgcaaatatgcctcgttttggttttagtcc |
31480448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #136
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 32119584 - 32119532
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||| |||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
32119584 |
ggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtcc |
32119532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #137
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 40169654 - 40169602
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |||| |||| ||||||||| |
|
|
| T |
40169654 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtcc |
40169602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #138
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 43441603 - 43441551
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
43441603 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
43441551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #139
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 45002385 - 45002333
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| ||| |||||||||||||||| |||||||||||||| |
|
|
| T |
45002385 |
ggctaaaatatggttttggtctctgcaaatatgcctcgttttggttttagtcc |
45002333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #140
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 47336228 - 47336280
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||| ||| |||||||||||||| |
|
|
| T |
47336228 |
ggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtcc |
47336280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #141
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 47336581 - 47336529
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||| |||| |||||||||||||| |
|
|
| T |
47336581 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
47336529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #142
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 48924240 - 48924188
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| ||||||| |||||||||||| |||||||||||||| |
|
|
| T |
48924240 |
ggctaaaatatggttttggtccctgtaaatatgcctcgttttggttttagtcc |
48924188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #143
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 50196657 - 50196605
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||||||||||||||| ||||||||||||| ||| |||||||||| |
|
|
| T |
50196657 |
ggctaaaatatggttttagtccctacaaatatgcctcgtttttgttttagtcc |
50196605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #144
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 51550446 - 51550394
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||| |||| |||||||||||||| |
|
|
| T |
51550446 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
51550394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #145
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 174 - 222
Target Start/End: Complemental strand, 51760117 - 51760069
Alignment:
| Q |
174 |
gctagaatatggttttagtccctgcaaatatgcctcggtttggttttag |
222 |
Q |
| |
|
|||| ||||||||| |||||||||||||||||||||| ||||||||||| |
|
|
| T |
51760117 |
gctaaaatatggttctagtccctgcaaatatgcctcgttttggttttag |
51760069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #146
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 52342583 - 52342531
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| ||| |||||||||||||||| |||||||||||||| |
|
|
| T |
52342583 |
ggctaaaatatggtttttgtctctgcaaatatgcctcgttttggttttagtcc |
52342531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #147
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 54608863 - 54608811
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||| |||| |||||||||||||| |
|
|
| T |
54608863 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
54608811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #148
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 174 - 225
Target Start/End: Original strand, 11463233 - 11463284
Alignment:
| Q |
174 |
gctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
|||| ||||||||||| || ||||||||||||||||| |||||||||||||| |
|
|
| T |
11463233 |
gctaaaatatggttttggttcctgcaaatatgcctcgttttggttttagtcc |
11463284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #149
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 173 - 224
Target Start/End: Complemental strand, 29490743 - 29490692
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtc |
224 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||| |||| ||||||||||||| |
|
|
| T |
29490743 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
29490692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #150
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 284 - 343
Target Start/End: Original strand, 40277931 - 40277990
Alignment:
| Q |
284 |
gtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattt |
343 |
Q |
| |
|
|||||| |||||||||||||||||||||||| ||||| ||||| || |||||||| |||| |
|
|
| T |
40277931 |
gtccctgaccccacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt |
40277990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #151
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 186 - 225
Target Start/End: Complemental strand, 43440774 - 43440735
Alignment:
| Q |
186 |
ttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
43440774 |
ttttagtccctgcaaatatgcctcgttttggttttagtcc |
43440735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #152
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 173 - 223
Target Start/End: Complemental strand, 474408 - 474358
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagt |
223 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||| |||| |||||||||||| |
|
|
| T |
474408 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
474358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #153
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 179 - 229
Target Start/End: Complemental strand, 2486896 - 2486846
Alignment:
| Q |
179 |
aatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgt |
229 |
Q |
| |
|
||||||||||| |||||||||||||||| ||| |||||||||| ||||||| |
|
|
| T |
2486896 |
aatatggttttggtccctgcaaatatgcttcgttttggttttaatccttgt |
2486846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #154
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 173 - 223
Target Start/End: Complemental strand, 4035053 - 4035003
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagt |
223 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||||||| ||| |||||||| |
|
|
| T |
4035053 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttagttttagt |
4035003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #155
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 278 - 344
Target Start/End: Complemental strand, 4814799 - 4814733
Alignment:
| Q |
278 |
aaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
|||||||||||| ||| || ||||||||||||||||||||||| ||||| || |||| ||| ||||| |
|
|
| T |
4814799 |
aaaatagtccctgacctcatttttgtgatgatttgcatacgtggcacatgatgactggacccatttt |
4814733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #156
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 179 - 229
Target Start/End: Complemental strand, 7518440 - 7518390
Alignment:
| Q |
179 |
aatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgt |
229 |
Q |
| |
|
|||||||||||| |||||||||||||| |||| |||||||||||| ||||| |
|
|
| T |
7518440 |
aatatggttttactccctgcaaatatgtctcgttttggttttagttcttgt |
7518390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #157
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 179 - 225
Target Start/End: Complemental strand, 8510523 - 8510477
Alignment:
| Q |
179 |
aatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||||||||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
8510523 |
aatatggttttagtccctgcaaatatgtttcgttttggttttagtcc |
8510477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #158
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 179 - 229
Target Start/End: Complemental strand, 8555302 - 8555252
Alignment:
| Q |
179 |
aatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgt |
229 |
Q |
| |
|
||||||||||| |||| ||||||||||| ||| |||||||||||||||||| |
|
|
| T |
8555302 |
aatatggttttggtccatgcaaatatgcatcgttttggttttagtccttgt |
8555252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #159
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 179 - 225
Target Start/End: Original strand, 9863053 - 9863098
Alignment:
| Q |
179 |
aatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| |||||||||||||| |
|
|
| T |
9863053 |
aatatggttttagtccctgc-aatatgcctcgttttggttttagtcc |
9863098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #160
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 179 - 225
Target Start/End: Original strand, 25710516 - 25710562
Alignment:
| Q |
179 |
aatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||||||||||||||||||||||||| |||| |||| ||||||||| |
|
|
| T |
25710516 |
aatatggttttagtccctgcaaatatgtctcgttttgattttagtcc |
25710562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #161
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 179 - 225
Target Start/End: Complemental strand, 30130498 - 30130452
Alignment:
| Q |
179 |
aatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
30130498 |
aatatggttttagtcactgcaaatatgcctcattttggttttagtcc |
30130452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #162
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 179 - 225
Target Start/End: Complemental strand, 35569130 - 35569084
Alignment:
| Q |
179 |
aatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||||||||| ||||||||||||||| |||| |||||||||||||| |
|
|
| T |
35569130 |
aatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
35569084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #163
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 173 - 223
Target Start/End: Original strand, 43441270 - 43441320
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagt |
223 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||| |||| |||||||||||| |
|
|
| T |
43441270 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
43441320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #164
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 179 - 221
Target Start/End: Complemental strand, 45006243 - 45006201
Alignment:
| Q |
179 |
aatatggttttagtccctgcaaatatgcctcggtttggtttta |
221 |
Q |
| |
|
||||| |||||||||||||||||||||||||| |||||||||| |
|
|
| T |
45006243 |
aatatagttttagtccctgcaaatatgcctcgttttggtttta |
45006201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #165
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 279 - 337
Target Start/End: Original strand, 50196401 - 50196459
Alignment:
| Q |
279 |
aaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaac |
337 |
Q |
| |
|
||||||||||| |||| | ||||||||||||||||||||||| ||||| || ||||||| |
|
|
| T |
50196401 |
aaatagtccctgaccctatttttgtgatgatttgcatacgtggcacatgatgactgaac |
50196459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #166
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 179 - 224
Target Start/End: Complemental strand, 20907451 - 20907406
Alignment:
| Q |
179 |
aatatggttttagtccctgcaaatatgcctcggtttggttttagtc |
224 |
Q |
| |
|
|||||||||||| |||||||||||||||||| ||||||||||||| |
|
|
| T |
20907451 |
aatatggttttaatccctgcaaatatgcctcattttggttttagtc |
20907406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #167
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 173 - 222
Target Start/End: Original strand, 21553889 - 21553938
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttag |
222 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||||||| ||| ||||||| |
|
|
| T |
21553889 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttagttttag |
21553938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #168
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 294 - 343
Target Start/End: Complemental strand, 30034353 - 30034304
Alignment:
| Q |
294 |
ccacttttgtgatgatttgcatacgtgacacattataactgaaccaattt |
343 |
Q |
| |
|
||||||||||||||||||||| ||||| ||||| || ||||||||||||| |
|
|
| T |
30034353 |
ccacttttgtgatgatttgcacacgtggcacatgatgactgaaccaattt |
30034304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #169
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 179 - 224
Target Start/End: Original strand, 40723124 - 40723169
Alignment:
| Q |
179 |
aatatggttttagtccctgcaaatatgcctcggtttggttttagtc |
224 |
Q |
| |
|
|||||||||||||||| ||||||||| ||||| ||||||||||||| |
|
|
| T |
40723124 |
aatatggttttagtccttgcaaatattcctcgatttggttttagtc |
40723169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #170
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 294 - 343
Target Start/End: Original strand, 45006005 - 45006054
Alignment:
| Q |
294 |
ccacttttgtgatgatttgcatacgtgacacattataactgaaccaattt |
343 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| || |||||||| |||| |
|
|
| T |
45006005 |
ccacttttgtgatgatttgcacacgtgacacatgatgactgaacccattt |
45006054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #171
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 179 - 224
Target Start/End: Original strand, 45161119 - 45161164
Alignment:
| Q |
179 |
aatatggttttagtccctgcaaatatgcctcggtttggttttagtc |
224 |
Q |
| |
|
|||||||||| |||||||||||||||| |||| ||||||||||||| |
|
|
| T |
45161119 |
aatatggtttaagtccctgcaaatatgtctcgttttggttttagtc |
45161164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #172
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 49670803 - 49670750
Alignment:
| Q |
173 |
ggctagaatatggttttagtccc-tgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||||||||| ||||||||||| ||| |||||||||||||| |
|
|
| T |
49670803 |
ggctaaaatatggttttagtcccctgcaaatatgcttcgttttggttttagtcc |
49670750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #173
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 294 - 347
Target Start/End: Original strand, 51058708 - 51058761
Alignment:
| Q |
294 |
ccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttata |
347 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| || ||||||| |||||||| |
|
|
| T |
51058708 |
ccacttttgtgatgatttgcatatgtgacacatgatgactgaactcattttata |
51058761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #174
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 4814898 - 4814847
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||||||||||||| |||||||||| |||| |||||||||||||| |
|
|
| T |
4814898 |
ggctaaaatatggttttagtcc-tgcaaatatgtctcgttttggttttagtcc |
4814847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #175
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 7957226 - 7957174
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||| |||| |||||||||||||||| ||| |||||||||||||| |
|
|
| T |
7957226 |
ggctaaaatatgattttggtccctgcaaatatgcgtcgttttggttttagtcc |
7957174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #176
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 9597095 - 9597043
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||| ||| |||||||||||||| |
|
|
| T |
9597095 |
ggctaaaatatggttttgttccctgcaaatatgcttcgttttggttttagtcc |
9597043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #177
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 173 - 221
Target Start/End: Complemental strand, 9603919 - 9603871
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggtttta |
221 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||||||| |||||||||| |
|
|
| T |
9603919 |
ggctaaaatatggttttggtccctgcaaatatgcctcattttggtttta |
9603871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #178
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 181 - 225
Target Start/End: Complemental strand, 14633881 - 14633837
Alignment:
| Q |
181 |
tatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||||||||||||||||||||||| || | |||||||||||||| |
|
|
| T |
14633881 |
tatggttttagtccctgcaaatatgtcttgttttggttttagtcc |
14633837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #179
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 15979701 - 15979649
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| |||||| |||||||| |||| |||||||||||||| |
|
|
| T |
15979701 |
ggctaaaatatggttttggtccctacaaatatgtctcgttttggttttagtcc |
15979649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #180
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 173 - 229
Target Start/End: Original strand, 28452147 - 28452203
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgt |
229 |
Q |
| |
|
||||| ||||||||||| |||| |||||||||| || | |||||||||||||||||| |
|
|
| T |
28452147 |
ggctaaaatatggttttggtccttgcaaatatgtcttgttttggttttagtccttgt |
28452203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #181
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 28452376 - 28452324
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| |||||| ||||||||| ||| |||||||||||||| |
|
|
| T |
28452376 |
ggctaaaatatggttttggtccctacaaatatgcttcgttttggttttagtcc |
28452324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #182
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 29686544 - 29686596
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||||||||||||||| |||| |||||||||| || | |||||||||||||| |
|
|
| T |
29686544 |
ggctagaatatggttttggtccatgcaaatatgtcttgttttggttttagtcc |
29686596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #183
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 30426226 - 30426175
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||||||||||||| ||||||||||||||| |||| ||||||||| |
|
|
| T |
30426226 |
ggctaaaatatggttttagtcc-tgcaaatatgcctcgttttgattttagtcc |
30426175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #184
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 30552478 - 30552426
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||| |||||||||| |||||||||| |||| |||||||||||||| |
|
|
| T |
30552478 |
ggctaaaatatcgttttagtccatgcaaatatgtctcgttttggttttagtcc |
30552426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #185
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 35565508 - 35565560
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| ||||||||||||| ||||| |||||||||||||| |
|
|
| T |
35565508 |
ggctaaaatatggttttgttccctgcaaatatacctcgttttggttttagtcc |
35565560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #186
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 173 - 229
Target Start/End: Original strand, 38232241 - 38232297
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgt |
229 |
Q |
| |
|
||||| |||||| |||| ||||||||||||||| |||| |||| ||||||||||||| |
|
|
| T |
38232241 |
ggctaaaatatgattttggtccctgcaaatatgtctcgttttgattttagtccttgt |
38232297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #187
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 173 - 229
Target Start/End: Complemental strand, 39072213 - 39072157
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgt |
229 |
Q |
| |
|
||||| |||||||||||||| ||||||||||||||||| |||| ||||| ||| ||| |
|
|
| T |
39072213 |
ggctaaaatatggttttagttcctgcaaatatgcctcgttttgattttaatccctgt |
39072157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #188
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 40169344 - 40169396
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||||||||| |||||||||||||| |||| |||| ||||||||| |
|
|
| T |
40169344 |
ggctaaaatatggttttaatccctgcaaatatgtctcgttttgattttagtcc |
40169396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #189
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 40545564 - 40545616
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||| |||| ||| |||||||||| |
|
|
| T |
40545564 |
ggctaaaatatggttttggtccctgcaaatatgactcgttttagttttagtcc |
40545616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #190
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 173 - 221
Target Start/End: Complemental strand, 40979710 - 40979662
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggtttta |
221 |
Q |
| |
|
||||| |||||||||||| |||||||||||||| |||| |||||||||| |
|
|
| T |
40979710 |
ggctaaaatatggttttaatccctgcaaatatggctcgttttggtttta |
40979662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #191
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 43440495 - 43440547
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||||||||||||| |||||||||| |||| ||| |||||||||| |
|
|
| T |
43440495 |
ggctaaaatatggttttagtccttgcaaatatgtctcgttttagttttagtcc |
43440547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #192
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 45313863 - 45313811
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||| ||| |||| ||||||||| |
|
|
| T |
45313863 |
ggctaaaatatggttttggtccctgcaaatatgcttcgttttgattttagtcc |
45313811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #193
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 47005154 - 47005206
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||| |||| ||| |||||||||| |
|
|
| T |
47005154 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttagttttagtcc |
47005206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #194
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 295 - 343
Target Start/End: Complemental strand, 47114694 - 47114646
Alignment:
| Q |
295 |
cacttttgtgatgatttgcatacgtgacacattataactgaaccaattt |
343 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| || |||||||| |||| |
|
|
| T |
47114694 |
cacttttgtgatgatttgcacacgtgacacatgatgactgaacccattt |
47114646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #195
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 51759819 - 51759871
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||| |||| |||||||||||| |||| |||||||||||||| |
|
|
| T |
51759819 |
ggctaaaatatggttctagttcctgcaaatatgtctcgttttggttttagtcc |
51759871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #196
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 173 - 221
Target Start/End: Original strand, 52342195 - 52342243
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggtttta |
221 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||||||| |||||||||| |
|
|
| T |
52342195 |
ggctaaaatatggttttggtccctgcaaatatgcctccttttggtttta |
52342243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #197
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 292 - 343
Target Start/End: Complemental strand, 2486785 - 2486734
Alignment:
| Q |
292 |
ccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattt |
343 |
Q |
| |
|
||||||||||||||||||||||| ||||| ||||| || |||||||| |||| |
|
|
| T |
2486785 |
ccccacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt |
2486734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #198
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 284 - 343
Target Start/End: Original strand, 4034826 - 4034885
Alignment:
| Q |
284 |
gtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattt |
343 |
Q |
| |
|
|||||| || ||||||||||||||||||||| ||||| ||||| || |||||||| |||| |
|
|
| T |
4034826 |
gtccctgactccacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt |
4034885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #199
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 173 - 224
Target Start/End: Original strand, 7588318 - 7588369
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtc |
224 |
Q |
| |
|
||||| ||||| ||||| |||||||||||||||||| | ||||||||||||| |
|
|
| T |
7588318 |
ggctaaaatatagttttggtccctgcaaatatgccttgttttggttttagtc |
7588369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #200
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 284 - 343
Target Start/End: Complemental strand, 8555199 - 8555140
Alignment:
| Q |
284 |
gtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattt |
343 |
Q |
| |
|
|||||| |||||||||||||||||||||||| ||||| |||| | ||||||||||||| |
|
|
| T |
8555199 |
gtccctgaccccacttttgtgatgatttgcacacgtgtcacacgacgactgaaccaattt |
8555140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #201
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 284 - 343
Target Start/End: Complemental strand, 9262045 - 9261986
Alignment:
| Q |
284 |
gtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattt |
343 |
Q |
| |
|
|||||| || ||||||||||||||||||||| ||||| ||||| || |||||||| |||| |
|
|
| T |
9262045 |
gtccctgactccacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt |
9261986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #202
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 174 - 225
Target Start/End: Original strand, 9596759 - 9596810
Alignment:
| Q |
174 |
gctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
|||| ||||||||||| ||| |||||||||||| ||| |||||||||||||| |
|
|
| T |
9596759 |
gctaaaatatggtttttgtctctgcaaatatgcatcgttttggttttagtcc |
9596810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #203
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 278 - 325
Target Start/End: Original strand, 28942627 - 28942674
Alignment:
| Q |
278 |
aaaatagtccctcaccccacttttgtgatgatttgcatacgtgacaca |
325 |
Q |
| |
|
||||||||| || | |||||||||||||||||||||||||||| |||| |
|
|
| T |
28942627 |
aaaatagtctctgatcccacttttgtgatgatttgcatacgtggcaca |
28942674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #204
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 173 - 224
Target Start/End: Original strand, 30424628 - 30424679
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtc |
224 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| || | ||| ||||||||| |
|
|
| T |
30424628 |
ggctaaaatatggttttagtccctgcaaatatgtcttgttttagttttagtc |
30424679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #205
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 298 - 337
Target Start/End: Original strand, 46901222 - 46901261
Alignment:
| Q |
298 |
ttttgtgatgatttgcatacgtgacacattataactgaac |
337 |
Q |
| |
|
|||| |||||||||||||||||||||||| |||||||||| |
|
|
| T |
46901222 |
ttttttgatgatttgcatacgtgacacatgataactgaac |
46901261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #206
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 173 - 224
Target Start/End: Original strand, 47114487 - 47114538
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtc |
224 |
Q |
| |
|
||||| |||||| |||| ||||||||||||||| |||| ||||||||||||| |
|
|
| T |
47114487 |
ggctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagtc |
47114538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #207
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 173 - 224
Target Start/End: Original strand, 51500398 - 51500449
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtc |
224 |
Q |
| |
|
||||| ||||||||| ||||| ||| |||||||||||| ||||||||||||| |
|
|
| T |
51500398 |
ggctaaaatatggttctagtctctgtaaatatgcctcgttttggttttagtc |
51500449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #208
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 291 - 338
Target Start/End: Original strand, 54767287 - 54767334
Alignment:
| Q |
291 |
accccacttttgtgatgatttgcatacgtgacacattataactgaacc |
338 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| || |||||||| |
|
|
| T |
54767287 |
accccacttttgtgatgatttgctcacgtgacacatgatgactgaacc |
54767334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #209
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 173 - 223
Target Start/End: Complemental strand, 275833 - 275783
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagt |
223 |
Q |
| |
|
||||| |||||| |||||||||||| |||||||| ||| |||||||||||| |
|
|
| T |
275833 |
ggctaaaatatgattttagtccctgtaaatatgcttcgttttggttttagt |
275783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #210
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 179 - 225
Target Start/End: Original strand, 3387271 - 3387317
Alignment:
| Q |
179 |
aatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||||||||| |||||||||||||| |||| |||||||||||||| |
|
|
| T |
3387271 |
aatatggttttgatccctgcaaatatgtctcgttttggttttagtcc |
3387317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #211
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 278 - 344
Target Start/End: Complemental strand, 15286402 - 15286336
Alignment:
| Q |
278 |
aaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||| || | |||| ||||||||||||||||||||||| ||||| || ||| |||| ||||| |
|
|
| T |
15286402 |
aaaatagtctctgatcccatttttgtgatgatttgcatacgtggcacatgatgactaaaccgatttt |
15286336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #212
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 183 - 229
Target Start/End: Complemental strand, 16123491 - 16123446
Alignment:
| Q |
183 |
tggttttagtccctgcaaatatgcctcggtttggttttagtccttgt |
229 |
Q |
| |
|
|||||||||||| ||||||||||||||| |||||||||||| ||||| |
|
|
| T |
16123491 |
tggttttagtcc-tgcaaatatgcctcgttttggttttagttcttgt |
16123446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #213
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 179 - 229
Target Start/End: Original strand, 16679682 - 16679732
Alignment:
| Q |
179 |
aatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgt |
229 |
Q |
| |
|
|||||||||||||||| || |||||||| ||| ||||||||||||| |||| |
|
|
| T |
16679682 |
aatatggttttagtccttgaaaatatgcttcgttttggttttagtctttgt |
16679732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #214
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 179 - 229
Target Start/End: Original strand, 30034113 - 30034163
Alignment:
| Q |
179 |
aatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgt |
229 |
Q |
| |
|
||||||||||| |||| || |||||||||||| |||||||||| ||||||| |
|
|
| T |
30034113 |
aatatggttttggtccttgtaaatatgcctcgttttggttttaatccttgt |
30034163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #215
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 173 - 223
Target Start/End: Original strand, 30128284 - 30128334
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagt |
223 |
Q |
| |
|
||||| ||||||||||| ||||||||||| ||| |||| |||||||||||| |
|
|
| T |
30128284 |
ggctaaaatatggttttggtccctgcaaacatgtctcgttttggttttagt |
30128334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #216
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 278 - 344
Target Start/End: Original strand, 30552246 - 30552312
Alignment:
| Q |
278 |
aaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||| || |||| | |||| |||||||||||||||||| ||||| || |||||||| ||||| |
|
|
| T |
30552246 |
aaaatagtcactgaccctatttttatgatgatttgcatacgtggcacatgatgactgaacccatttt |
30552312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #217
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 179 - 225
Target Start/End: Original strand, 31869600 - 31869646
Alignment:
| Q |
179 |
aatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
|||||||||||| | |||||||||||| |||| |||||||||||||| |
|
|
| T |
31869600 |
aatatggttttaattcctgcaaatatgtctcgttttggttttagtcc |
31869646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #218
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 173 - 223
Target Start/End: Original strand, 35177255 - 35177305
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagt |
223 |
Q |
| |
|
||||| |||||| |||| ||||||||||||||| |||| |||||||||||| |
|
|
| T |
35177255 |
ggctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagt |
35177305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #219
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 291 - 337
Target Start/End: Original strand, 35533393 - 35533439
Alignment:
| Q |
291 |
accccacttttgtgatgatttgcatacgtgacacattataactgaac |
337 |
Q |
| |
|
|||||||||||||||||||||||| ||||| ||||| || ||||||| |
|
|
| T |
35533393 |
accccacttttgtgatgatttgcacacgtggcacatgatgactgaac |
35533439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #220
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 284 - 326
Target Start/End: Original strand, 36673072 - 36673114
Alignment:
| Q |
284 |
gtccctcaccccacttttgtgatgatttgcatacgtgacacat |
326 |
Q |
| |
|
|||||| ||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
36673072 |
gtccctgaccccacttttgtgatgatttacatacgtggcacat |
36673114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #221
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 285 - 343
Target Start/End: Complemental strand, 38232498 - 38232440
Alignment:
| Q |
285 |
tccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattt |
343 |
Q |
| |
|
||||| ||| |||||||||||||||||| | ||||||||||| || |||||||| |||| |
|
|
| T |
38232498 |
tccctgacctcacttttgtgatgatttgtacacgtgacacatgatgactgaacccattt |
38232440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #222
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 298 - 344
Target Start/End: Original strand, 43440614 - 43440660
Alignment:
| Q |
298 |
ttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||||||||||||||| ||||| || |||||||| ||||| |
|
|
| T |
43440614 |
ttttgtgatgatttgcatacgtggcacatgatgactgaacccatttt |
43440660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #223
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 293 - 343
Target Start/End: Complemental strand, 44802496 - 44802446
Alignment:
| Q |
293 |
cccacttttgtgatgatttgcatacgtgacacattataactgaaccaattt |
343 |
Q |
| |
|
|||||||||||||||||||||| || |||||||| || |||||||| |||| |
|
|
| T |
44802496 |
cccacttttgtgatgatttgcacacatgacacataatgactgaacctattt |
44802446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #224
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 173 - 223
Target Start/End: Original strand, 46901104 - 46901154
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagt |
223 |
Q |
| |
|
||||| ||||||||||||||| ||||||||||| ||| |||||||||||| |
|
|
| T |
46901104 |
ggctaaaatatggttttagtctctgcaaatatgtatcgttttggttttagt |
46901154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #225
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 179 - 225
Target Start/End: Original strand, 47901806 - 47901852
Alignment:
| Q |
179 |
aatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||||||||||||| ||| |||||||| ||| |||||||||||||| |
|
|
| T |
47901806 |
aatatggttttagtctctggaaatatgcatcgttttggttttagtcc |
47901852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #226
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 179 - 225
Target Start/End: Complemental strand, 49324140 - 49324094
Alignment:
| Q |
179 |
aatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||||||||| ||||||| ||||||| |||| |||||||||||||| |
|
|
| T |
49324140 |
aatatggttttggtccctgtaaatatgtctcgttttggttttagtcc |
49324094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #227
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 294 - 343
Target Start/End: Complemental strand, 9596976 - 9596927
Alignment:
| Q |
294 |
ccacttttgtgatgatttgcatacgtgacacattataactgaaccaattt |
343 |
Q |
| |
|
||||||||| ||||||||||||||||| ||||| || |||||||| |||| |
|
|
| T |
9596976 |
ccacttttgagatgatttgcatacgtggcacatgatgactgaacccattt |
9596927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #228
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 284 - 337
Target Start/End: Original strand, 9603738 - 9603791
Alignment:
| Q |
284 |
gtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaac |
337 |
Q |
| |
|
|||||| || ||||||||||||||||||||| ||||| ||||| || ||||||| |
|
|
| T |
9603738 |
gtccctgactccacttttgtgatgatttgcacacgtgtcacatgatgactgaac |
9603791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #229
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 173 - 210
Target Start/End: Original strand, 18175791 - 18175828
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcg |
210 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |||| |
|
|
| T |
18175791 |
ggctaaaatatggttttagtccctgcaaatatgtctcg |
18175828 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #230
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 173 - 210
Target Start/End: Complemental strand, 26273824 - 26273787
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcg |
210 |
Q |
| |
|
||||| ||||||||||||||||| |||||||||||||| |
|
|
| T |
26273824 |
ggctaaaatatggttttagtcccagcaaatatgcctcg |
26273787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #231
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 294 - 343
Target Start/End: Original strand, 35177374 - 35177423
Alignment:
| Q |
294 |
ccacttttgtgatgatttgcatacgtgacacattataactgaaccaattt |
343 |
Q |
| |
|
||||||||||||||||||||| ||||| ||||| || |||||||| |||| |
|
|
| T |
35177374 |
ccacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt |
35177423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #232
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 294 - 343
Target Start/End: Original strand, 35565627 - 35565676
Alignment:
| Q |
294 |
ccacttttgtgatgatttgcatacgtgacacattataactgaaccaattt |
343 |
Q |
| |
|
||||||||||||||||||||| ||||| ||||| || |||||||| |||| |
|
|
| T |
35565627 |
ccacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt |
35565676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #233
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 292 - 337
Target Start/End: Complemental strand, 39132790 - 39132745
Alignment:
| Q |
292 |
ccccacttttgtgatgatttgcatacgtgacacattataactgaac |
337 |
Q |
| |
|
||||||||||||||||||||||| ||||||| ||| || ||||||| |
|
|
| T |
39132790 |
ccccacttttgtgatgatttgcacacgtgacgcatgatgactgaac |
39132745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #234
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 279 - 344
Target Start/End: Complemental strand, 45313759 - 45313694
Alignment:
| Q |
279 |
aaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| ||| ||| | ||| || |||||||| ||||| |
|
|
| T |
45313759 |
aaatagtccctggccccacttttgtgatgatttgtatatgtggcgcatgatgactgaacccatttt |
45313694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #235
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 294 - 343
Target Start/End: Complemental strand, 52956581 - 52956532
Alignment:
| Q |
294 |
ccacttttgtgatgatttgcatacgtgacacattataactgaaccaattt |
343 |
Q |
| |
|
|||||||||||||||||| || ||||||||||| || |||||||| |||| |
|
|
| T |
52956581 |
ccacttttgtgatgatttacacacgtgacacatgatgactgaacccattt |
52956532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #236
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 179 - 223
Target Start/End: Original strand, 2486585 - 2486629
Alignment:
| Q |
179 |
aatatggttttagtccctgcaaatatgcctcggtttggttttagt |
223 |
Q |
| |
|
||||||||||| ||||||||||||||| ||| |||||||||||| |
|
|
| T |
2486585 |
aatatggtttttgtccctgcaaatatgactcattttggttttagt |
2486629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #237
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 179 - 223
Target Start/End: Original strand, 10778376 - 10778420
Alignment:
| Q |
179 |
aatatggttttagtccctgcaaatatgcctcggtttggttttagt |
223 |
Q |
| |
|
|||||||||||||| |||||||||||||||| |||| ||||||| |
|
|
| T |
10778376 |
aatatggttttagtttctgcaaatatgcctcgttttgattttagt |
10778420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #238
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 179 - 223
Target Start/End: Complemental strand, 12673975 - 12673931
Alignment:
| Q |
179 |
aatatggttttagtccctgcaaatatgcctcggtttggttttagt |
223 |
Q |
| |
|
|||||| ||||||| |||||||||||||||| |||||||||||| |
|
|
| T |
12673975 |
aatatgattttagttcctgcaaatatgcctcattttggttttagt |
12673931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #239
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 292 - 348
Target Start/End: Complemental strand, 13514459 - 13514403
Alignment:
| Q |
292 |
ccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattttatag |
348 |
Q |
| |
|
|||||||||| |||| ||||||| | ||||||||| || ||||| |||||||||||| |
|
|
| T |
13514459 |
ccccacttttatgattatttgcacatgtgacacatgatgactgatccaattttatag |
13514403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #240
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 13514577 - 13514525
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||| |||| || |||||||||||| |||| |||||||||||||| |
|
|
| T |
13514577 |
ggctaaaatatgattttggtacctgcaaatatgtctcgttttggttttagtcc |
13514525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #241
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 19844265 - 19844317
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| |||||| ||||||||||||| ||| ||||||||| |
|
|
| T |
19844265 |
ggctaaaatatggttttggtccctacaaatatgcctcgttttaattttagtcc |
19844317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #242
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 295 - 343
Target Start/End: Original strand, 19844386 - 19844434
Alignment:
| Q |
295 |
cacttttgtgatgatttgcatacgtgacacattataactgaaccaattt |
343 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| || | |||||| |||| |
|
|
| T |
19844386 |
cacttttgtgatgatttgcacacgtgacacatgatgagtgaacccattt |
19844434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #243
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 173 - 205
Target Start/End: Complemental strand, 26800169 - 26800137
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatg |
205 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |
|
|
| T |
26800169 |
ggctaaaatatggttttagtccctgcaaatatg |
26800137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #244
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 173 - 221
Target Start/End: Complemental strand, 27681682 - 27681634
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggtttta |
221 |
Q |
| |
|
||||| ||||||||| | ||| |||||||||||||||| |||||||||| |
|
|
| T |
27681682 |
ggctaaaatatggttctggtctctgcaaatatgcctcgttttggtttta |
27681634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #245
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 292 - 336
Target Start/End: Original strand, 28418658 - 28418702
Alignment:
| Q |
292 |
ccccacttttgtgatgatttgcatacgtgacacattataactgaa |
336 |
Q |
| |
|
||||||||||||||||||||||| ||||| ||||| || |||||| |
|
|
| T |
28418658 |
ccccacttttgtgatgatttgcacacgtggcacatgatgactgaa |
28418702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #246
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 29678024 - 29678076
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||| ||||| ||| ||||||||||||||| |||||||||||||| |
|
|
| T |
29678024 |
ggctaaaatatagttttggtctttgcaaatatgcctcgttttggttttagtcc |
29678076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #247
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 30034472 - 30034420
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| ||| |||||||||| |||| |||||||||||||| |
|
|
| T |
30034472 |
ggctaaaatatggttttgctccttgcaaatatgtctcgttttggttttagtcc |
30034420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #248
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 32119220 - 32119272
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||| ||||| ||||||||||||||| |||| ||| |||||||||| |
|
|
| T |
32119220 |
ggctaaaatatagttttggtccctgcaaatatgtctcgttttagttttagtcc |
32119272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #249
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 173 - 221
Target Start/End: Original strand, 40277822 - 40277870
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggtttta |
221 |
Q |
| |
|
||||| ||| ||||||| |||||||||||||||| ||| |||||||||| |
|
|
| T |
40277822 |
ggctaaaatgtggttttggtccctgcaaatatgcttcgttttggtttta |
40277870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #250
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 46622129 - 46622077
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| |||| |||||||||| ||| |||||||||||||| |
|
|
| T |
46622129 |
ggctaaaatatggttttggtccttgcaaatatgtttcgttttggttttagtcc |
46622077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #251
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 47902145 - 47902093
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||| ||||||||||| |||||||||| | | |||||||||||||| |
|
|
| T |
47902145 |
ggctaaaatatagttttagtccccgcaaatatgcattgttttggttttagtcc |
47902093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #252
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 284 - 336
Target Start/End: Complemental strand, 52342473 - 52342421
Alignment:
| Q |
284 |
gtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaa |
336 |
Q |
| |
|
|||||| || ||||||||||||||||||||| ||||| ||||| || |||||| |
|
|
| T |
52342473 |
gtccctgactccacttttgtgatgatttgcacacgtggcacatgatgactgaa |
52342421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #253
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 291 - 343
Target Start/End: Original strand, 53113499 - 53113551
Alignment:
| Q |
291 |
accccacttttgtgatgatttgcatacgtgacacattataactgaaccaattt |
343 |
Q |
| |
|
|||||||||||||||||||||||| || || ||||| || |||||||| |||| |
|
|
| T |
53113499 |
accccacttttgtgatgatttgcacacatggcacatgatgactgaacctattt |
53113551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0370 (Bit Score: 62; Significance: 1e-26; HSPs: 1)
Name: scaffold0370
Description:
Target: scaffold0370; HSP #1
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 173 - 344
Target Start/End: Complemental strand, 289 - 121
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgtnnnnnnnnnnnnnnttgtttttggtccctgcaaaannnnnnnn |
272 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |||| |||||||||||||| || ||||||||||||||||||||| |
|
|
| T |
289 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg---gtaaaaaaaaaattgtttttggtccctgcaaaattttttgt |
193 |
T |
 |
| Q |
273 |
nnnngaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
192 |
ttttgaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaatttt |
121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0021 (Bit Score: 61; Significance: 6e-26; HSPs: 2)
Name: scaffold0021
Description:
Target: scaffold0021; HSP #1
Raw Score: 61; E-Value: 6e-26
Query Start/End: Original strand, 173 - 344
Target Start/End: Original strand, 12182 - 12351
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgtnnnnnnnnnnnnnnttgtttttggtccctgcaaaannnnnnnn |
272 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| ||| |||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
12182 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttagttttagtccctgtaaaataaaaatt--ttgtttttggtccctgcaaaattttttgt |
12279 |
T |
 |
| Q |
273 |
nnnngaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
12280 |
ttttgaaaatagtccctgaccccacttttgtgatgatttgtatacgtggcacattataactgaaccaatttt |
12351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0021; HSP #2
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 173 - 229
Target Start/End: Complemental strand, 12536 - 12480
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgt |
229 |
Q |
| |
|
||||| |||||| ||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
12536 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccttgt |
12480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0016 (Bit Score: 60; Significance: 2e-25; HSPs: 3)
Name: scaffold0016
Description:
Target: scaffold0016; HSP #1
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 277 - 344
Target Start/End: Original strand, 10257 - 10324
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
10257 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataattgaaccaatttt |
10324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0016; HSP #2
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 173 - 226
Target Start/End: Original strand, 10168 - 10221
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcct |
226 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||| | ||||||||||||||| |
|
|
| T |
10168 |
ggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtcct |
10221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0016; HSP #3
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 173 - 223
Target Start/End: Complemental strand, 10515 - 10465
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagt |
223 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| || | |||||||||||| |
|
|
| T |
10515 |
ggctaaaatatggttttagtccctgcaaatatgtctggttttggttttagt |
10465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0373 (Bit Score: 58; Significance: 3e-24; HSPs: 1)
Name: scaffold0373
Description:
Target: scaffold0373; HSP #1
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 173 - 344
Target Start/End: Original strand, 8547 - 8716
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgtnnnnnnnnnnnnnnttgtttttggtccctgcaaaannnnnnnn |
272 |
Q |
| |
|
||||| |||||| ||||||||||||||||||||||||| |||||||||||||| || ||||||||||||||||||||| |
|
|
| T |
8547 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctg--gtaaaaaaaaaatttgtttttggtccctgcaaaattttttgt |
8644 |
T |
 |
| Q |
273 |
nnnngaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||||| | |||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
8645 |
ttttgaaaatagtccctgatcccacttttgtgatgatttgcatacgtggcacattataactgaaccaatttt |
8716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0712 (Bit Score: 57; Significance: 1e-23; HSPs: 1)
Name: scaffold0712
Description:
Target: scaffold0712; HSP #1
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 173 - 344
Target Start/End: Original strand, 5209 - 5378
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgtnnnnnnnnnnnnnnttgtttttggtccctgcaaaannnnnnnn |
272 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |||||||||| ||| ||| ||||||||||||||| ||||| |
|
|
| T |
5209 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttattccctgtaaaaataaaatt--ttgtttttggtccctccaaaaaattttgt |
5306 |
T |
 |
| Q |
273 |
nnnngaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
|||||||||| || |||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
5307 |
ttttgaaaatagtcactgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaatttt |
5378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0709 (Bit Score: 57; Significance: 1e-23; HSPs: 1)
Name: scaffold0709
Description:
Target: scaffold0709; HSP #1
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 173 - 344
Target Start/End: Original strand, 5229 - 5398
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgtnnnnnnnnnnnnnnttgtttttggtccctgcaaaannnnnnnn |
272 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |||||||||| ||| ||| ||||||||||||||| ||||| |
|
|
| T |
5229 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttattccctgtaaaaataaaatt--ttgtttttggtccctccaaaaaattttgt |
5326 |
T |
 |
| Q |
273 |
nnnngaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
|||||||||| || |||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
5327 |
ttttgaaaatagtcactgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaatttt |
5398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0535 (Bit Score: 57; Significance: 1e-23; HSPs: 2)
Name: scaffold0535
Description:
Target: scaffold0535; HSP #1
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 173 - 344
Target Start/End: Complemental strand, 9028 - 8860
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgtnnnnnnnnnnnnnnttgtttttggtccctgcaaaannnnnnnn |
272 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |||||||||||||| ||| ||||||||||||||| ||||| |
|
|
| T |
9028 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaactt--ttgtttttggtccctacaaaattttttgt |
8931 |
T |
 |
| Q |
273 |
nnnngaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||||| |||||||||| ||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
8930 |
ttttgaaaatagtccctgaccccacttt-gtgatgatttgcatacgtggcacattataactgaaccaatttt |
8860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0535; HSP #2
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 179 - 225
Target Start/End: Original strand, 8738 - 8784
Alignment:
| Q |
179 |
aatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
8738 |
aatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
8784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0159 (Bit Score: 57; Significance: 1e-23; HSPs: 2)
Name: scaffold0159
Description:
Target: scaffold0159; HSP #1
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 277 - 345
Target Start/End: Complemental strand, 35170 - 35102
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttta |
345 |
Q |
| |
|
||||||||||| | |||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
35170 |
gaaaatagtccttgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaatttta |
35102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0159; HSP #2
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 34931 - 34983
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
34931 |
ggctaaaatatggtcttagtccctgcaaatatgcctcgttttggttttagtcc |
34983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0210 (Bit Score: 56; Significance: 5e-23; HSPs: 3)
Name: scaffold0210
Description:
Target: scaffold0210; HSP #1
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 277 - 344
Target Start/End: Original strand, 14797 - 14864
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
14797 |
gaaaatagtccctggccccacttttgtgatgatttgcatacgtggcacattataactgaaccaatttt |
14864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0210; HSP #2
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 14697 - 14749
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
14697 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
14749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0210; HSP #3
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 15012 - 14960
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
15012 |
ggctaaaatatggttttagtccctgcaaatatgtctcattttggttttagtcc |
14960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0123 (Bit Score: 56; Significance: 5e-23; HSPs: 2)
Name: scaffold0123
Description:
Target: scaffold0123; HSP #1
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 277 - 344
Target Start/End: Complemental strand, 17942 - 17875
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
17942 |
gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgtcactttataactgaaccaatttt |
17875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0123; HSP #2
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 229
Target Start/End: Complemental strand, 18043 - 17987
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgt |
229 |
Q |
| |
|
||||| |||||||||||||||||||| ||||||||||| ||||| |||||||| ||| |
|
|
| T |
18043 |
ggctaaaatatggttttagtccctgcgaatatgcctcgttttggatttagtccctgt |
17987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0347 (Bit Score: 53; Significance: 3e-21; HSPs: 2)
Name: scaffold0347
Description:
Target: scaffold0347; HSP #1
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 173 - 344
Target Start/End: Complemental strand, 4312 - 4145
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgtnnnnnnnnnnnnnnttgtttttggtccctgcaaaannnnnnnn |
272 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |||||||| ||||||||| |||||||| |||||||||||| |
|
|
| T |
4312 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttgagtccttgtaaaaaaaaat----ttgtttttcgtccctgcaaaattttttgt |
4217 |
T |
 |
| Q |
273 |
nnnngaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||| |||| |||||||||||||||||||||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
4216 |
ttttaaaaatagaccctgaccccacttttgtgatgatttgtatacgtggcacattataactgaaccaatttt |
4145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0347; HSP #2
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 180 - 225
Target Start/End: Original strand, 4016 - 4061
Alignment:
| Q |
180 |
atatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||||||||||||||| ||||||||||||| |||||||||||||| |
|
|
| T |
4016 |
atatggttttagtccctacaaatatgcctcgttttggttttagtcc |
4061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0811 (Bit Score: 52; Significance: 1e-20; HSPs: 3)
Name: scaffold0811
Description:
Target: scaffold0811; HSP #1
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 277 - 344
Target Start/End: Complemental strand, 1542 - 1475
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
|||||||||| || |||||||||||||||||||||||||| ||| ||||||||||||||||||||||| |
|
|
| T |
1542 |
gaaaatagtctctgaccccacttttgtgatgatttgcatatgtggcacattataactgaaccaatttt |
1475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0811; HSP #2
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 1311 - 1363
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |||| |||||||||||||| |
|
|
| T |
1311 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
1363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0811; HSP #3
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 1644 - 1592
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||| |||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
1644 |
ggctaaaatatgaatttagtccctgcaaatatgcctcgttttggttttagtcc |
1592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0051 (Bit Score: 52; Significance: 1e-20; HSPs: 3)
Name: scaffold0051
Description:
Target: scaffold0051; HSP #1
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 277 - 344
Target Start/End: Complemental strand, 5605 - 5538
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
|||||||||||| ||||||| |||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
5605 |
gaaaatagtccccgaccccacgtttgtgatgatttgcatacgtggcacattataactgaaccaatttt |
5538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0051; HSP #2
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 173 - 224
Target Start/End: Original strand, 5399 - 5450
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtc |
224 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||| | ||||||||||||| |
|
|
| T |
5399 |
ggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtc |
5450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0051; HSP #3
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 5708 - 5656
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| || | |||||||||||||| |
|
|
| T |
5708 |
ggctaaaatatggttttagtccctgcaaatatgtcttgttttggttttagtcc |
5656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0179 (Bit Score: 48; Significance: 3e-18; HSPs: 2)
Name: scaffold0179
Description:
Target: scaffold0179; HSP #1
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 277 - 344
Target Start/End: Complemental strand, 3191 - 3124
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
|||||||||| || |||||||||||||||||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
3191 |
gaaaatagtctctgaccccacttttgtgatgatttgcatacgtggtacattataactgaatcaatttt |
3124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0179; HSP #2
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 229
Target Start/End: Complemental strand, 3291 - 3235
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgt |
229 |
Q |
| |
|
||||| |||||||||||| |||||||||||||| |||| |||||||||||||| ||| |
|
|
| T |
3291 |
ggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtccctgt |
3235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1001 (Bit Score: 45; Significance: 2e-16; HSPs: 1)
Name: scaffold1001
Description:
Target: scaffold1001; HSP #1
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 2778 - 2830
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
2778 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
2830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0337 (Bit Score: 45; Significance: 2e-16; HSPs: 1)
Name: scaffold0337
Description:
Target: scaffold0337; HSP #1
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 173 - 229
Target Start/End: Original strand, 12525 - 12581
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgt |
229 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |||| |||||||||||||||||| |
|
|
| T |
12525 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccttgt |
12581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0065 (Bit Score: 45; Significance: 2e-16; HSPs: 2)
Name: scaffold0065
Description:
Target: scaffold0065; HSP #1
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 173 - 229
Target Start/End: Original strand, 3532 - 3588
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgt |
229 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |||| |||||||||||||||||| |
|
|
| T |
3532 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccttgt |
3588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0065; HSP #2
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 3918 - 3866
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
3918 |
ggctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagtcc |
3866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0003 (Bit Score: 45; Significance: 2e-16; HSPs: 3)
Name: scaffold0003
Description:
Target: scaffold0003; HSP #1
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 366273 - 366221
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
366273 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
366221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0003; HSP #2
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 365979 - 366031
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||||||||| ||| ||||||||||||||| |||||||||||||| |
|
|
| T |
365979 |
ggctaaaatatggttttaatccttgcaaatatgcctcgttttggttttagtcc |
366031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0003; HSP #3
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 278 - 344
Target Start/End: Complemental strand, 366174 - 366108
Alignment:
| Q |
278 |
aaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||| |||||| ||||||||||||||| ||||||| ||||| || |||||||| ||||| |
|
|
| T |
366174 |
aaaatagtccccgaccccatttttgtgatgatttgtatacgtggcacatgatgactgaacctatttt |
366108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0326 (Bit Score: 44; Significance: 8e-16; HSPs: 6)
Name: scaffold0326
Description:
Target: scaffold0326; HSP #1
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 173 - 228
Target Start/End: Original strand, 4041 - 4096
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttg |
228 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |||| ||||||||||||||||| |
|
|
| T |
4041 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccttg |
4096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0326; HSP #2
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 173 - 228
Target Start/End: Original strand, 19223 - 19278
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttg |
228 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |||| ||||||||||||||||| |
|
|
| T |
19223 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccttg |
19278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0326; HSP #3
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 173 - 228
Target Start/End: Complemental strand, 4288 - 4233
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttg |
228 |
Q |
| |
|
||||| |||||||||||| |||||||||||||| |||| ||||||||||||||||| |
|
|
| T |
4288 |
ggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtccttg |
4233 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0326; HSP #4
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 173 - 228
Target Start/End: Complemental strand, 19470 - 19415
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttg |
228 |
Q |
| |
|
||||| |||||||||||| |||||||||||||| |||| ||||||||||||||||| |
|
|
| T |
19470 |
ggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtccttg |
19415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0326; HSP #5
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 286 - 333
Target Start/End: Original strand, 4128 - 4175
Alignment:
| Q |
286 |
ccctcaccccacttttgtgatgatttgcatacgtgacacattataact |
333 |
Q |
| |
|
|||| ||||||||| || ||||||||||||||||| |||||||||||| |
|
|
| T |
4128 |
ccctgaccccacttctgggatgatttgcatacgtggcacattataact |
4175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0326; HSP #6
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 286 - 333
Target Start/End: Original strand, 19310 - 19357
Alignment:
| Q |
286 |
ccctcaccccacttttgtgatgatttgcatacgtgacacattataact |
333 |
Q |
| |
|
|||| ||||||||| || ||||||||||||||||| |||||||||||| |
|
|
| T |
19310 |
ccctgaccccacttctgggatgatttgcatacgtggcacattataact |
19357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0060 (Bit Score: 41; Significance: 0.00000000000005; HSPs: 2)
Name: scaffold0060
Description:
Target: scaffold0060; HSP #1
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 344
Target Start/End: Original strand, 8330 - 8499
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgtnnnnnnnnnnnnnnttgtttttggtccctgcaaaannnnnnnn |
272 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |||| |||| ||||||||||||| ||||||||||||| ||||||| |
|
|
| T |
8330 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccttgtaaaaaaaaaaaa--ttgtttttggtccttgcaaaattttttgt |
8427 |
T |
 |
| Q |
273 |
nnnngaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
||||||||||||| |||||| ||||||||||||||||||| ||| ||||| || |||||||| ||||| |
|
|
| T |
8428 |
ttttgaaaatagtccctgaccccatttttgtgatgatttgcatatgtggcacatgatgactgaacccatttt |
8499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0060; HSP #2
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 229
Target Start/End: Complemental strand, 8642 - 8586
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgt |
229 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |||| |||| ||||||||||||| |
|
|
| T |
8642 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccttgt |
8586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0056 (Bit Score: 41; Significance: 0.00000000000005; HSPs: 3)
Name: scaffold0056
Description:
Target: scaffold0056; HSP #1
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 54815 - 54867
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
54815 |
ggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtcc |
54867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0056; HSP #2
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 179 - 225
Target Start/End: Complemental strand, 50072 - 50026
Alignment:
| Q |
179 |
aatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||||||||| ||||||||||||||| |||| |||||||||||||| |
|
|
| T |
50072 |
aatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
50026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0056; HSP #3
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 179 - 225
Target Start/End: Complemental strand, 55173 - 55127
Alignment:
| Q |
179 |
aatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||||||||| ||||||||||||||| |||| |||||||||||||| |
|
|
| T |
55173 |
aatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
55127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0026 (Bit Score: 41; Significance: 0.00000000000005; HSPs: 3)
Name: scaffold0026
Description:
Target: scaffold0026; HSP #1
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 82706 - 82654
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
82706 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
82654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0026; HSP #2
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 82341 - 82393
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| ||||||||||||| | |||| |||||||||||||| |
|
|
| T |
82341 |
ggctaaaatatggttttggtccctgcaaatacgtctcgttttggttttagtcc |
82393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0026; HSP #3
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 294 - 343
Target Start/End: Original strand, 82460 - 82509
Alignment:
| Q |
294 |
ccacttttgtgatgatttgcatacgtgacacattataactgaaccaattt |
343 |
Q |
| |
|
||||||||||||||||||||| ||||| ||||| || ||| ||||||||| |
|
|
| T |
82460 |
ccacttttgtgatgatttgcacacgtggcacatgatgactaaaccaattt |
82509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0024 (Bit Score: 41; Significance: 0.00000000000005; HSPs: 2)
Name: scaffold0024
Description:
Target: scaffold0024; HSP #1
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 75764 - 75712
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
75764 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
75712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0024; HSP #2
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 75359 - 75411
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| |||||||||||||| |||| |||||||||||||| |
|
|
| T |
75359 |
ggctaaaatatggttttgctccctgcaaatatgtctcgttttggttttagtcc |
75411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002 (Bit Score: 39; Significance: 0.0000000000008; HSPs: 3)
Name: scaffold0002
Description:
Target: scaffold0002; HSP #1
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 278 - 344
Target Start/End: Original strand, 94160 - 94226
Alignment:
| Q |
278 |
aaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
|||||||||| | |||||| ||||||||||||||||||||||| ||||| || |||||||| ||||| |
|
|
| T |
94160 |
aaaatagtccttgaccccatttttgtgatgatttgcatacgtggcacatgatgactgaacccatttt |
94226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002; HSP #2
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 221
Target Start/End: Original strand, 94057 - 94105
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggtttta |
221 |
Q |
| |
|
||||| |||||||||||||||||| ||||||||||||| |||||||||| |
|
|
| T |
94057 |
ggctaaaatatggttttagtccctacaaatatgcctcgttttggtttta |
94105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002; HSP #3
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 174 - 221
Target Start/End: Complemental strand, 94329 - 94282
Alignment:
| Q |
174 |
gctagaatatggttttagtccctgcaaatatgcctcggtttggtttta |
221 |
Q |
| |
|
|||| |||||||||||||||||| ||||||||||||| |||||||||| |
|
|
| T |
94329 |
gctaaaatatggttttagtccctacaaatatgcctcgttttggtttta |
94282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0684 (Bit Score: 37; Significance: 0.00000000001; HSPs: 3)
Name: scaffold0684
Description:
Target: scaffold0684; HSP #1
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 2660 - 2608
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||||| | |||||||||||||| |
|
|
| T |
2660 |
ggctaaaatatggttttggtccctgcaaatatgccttgttttggttttagtcc |
2608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0684; HSP #2
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 292 - 343
Target Start/End: Original strand, 2412 - 2463
Alignment:
| Q |
292 |
ccccacttttgtgatgatttgcatacgtgacacattataactgaaccaattt |
343 |
Q |
| |
|
||||||||||||||||||||||| ||||| ||||| || |||||||| |||| |
|
|
| T |
2412 |
ccccacttttgtgatgatttgcacacgtggcacatgatgactgaacccattt |
2463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0684; HSP #3
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 173 - 221
Target Start/End: Original strand, 2334 - 2382
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggtttta |
221 |
Q |
| |
|
||||| ||||||||||| |||||||||||||| ||| | |||||||||| |
|
|
| T |
2334 |
ggctataatatggttttggtccctgcaaatattccttgttttggtttta |
2382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0176 (Bit Score: 37; Significance: 0.00000000001; HSPs: 1)
Name: scaffold0176
Description:
Target: scaffold0176; HSP #1
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 229
Target Start/End: Complemental strand, 22055 - 21999
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtccttgt |
229 |
Q |
| |
|
||||| ||||||||||| |||||| ||||| ||||||| |||||||||||||||||| |
|
|
| T |
22055 |
ggctaaaatatggttttggtcccttcaaatttgcctcgttttggttttagtccttgt |
21999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0166 (Bit Score: 37; Significance: 0.00000000001; HSPs: 2)
Name: scaffold0166
Description:
Target: scaffold0166; HSP #1
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 24372 - 24424
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||||||| ||||||||||| |||| |||||||||||||| |
|
|
| T |
24372 |
ggctaaaatatggttttagtcactgcaaatatgtctcgttttggttttagtcc |
24424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0166; HSP #2
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 277 - 344
Target Start/End: Complemental strand, 24558 - 24491
Alignment:
| Q |
277 |
gaaaatagtccctcaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaatttt |
344 |
Q |
| |
|
|||||||||| || |||| || ||||||||||||||||||||| | ||||||| ||||||||||||| |
|
|
| T |
24558 |
gaaaatagtctctgaccctgctgttgtgatgatttgcatacgtggcgcattatatctgaaccaatttt |
24491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0160 (Bit Score: 37; Significance: 0.00000000001; HSPs: 1)
Name: scaffold0160
Description:
Target: scaffold0160; HSP #1
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 27364 - 27312
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||| |||| |||||||||||||| |
|
|
| T |
27364 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
27312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0105 (Bit Score: 37; Significance: 0.00000000001; HSPs: 1)
Name: scaffold0105
Description:
Target: scaffold0105; HSP #1
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 17966 - 17914
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| || ||||| ||||| |
|
|
| T |
17966 |
ggctaaaatatggttttagtccctgcaaatatgcctcgtttcggtttcagtcc |
17914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005 (Bit Score: 37; Significance: 0.00000000001; HSPs: 4)
Name: scaffold0005
Description:
Target: scaffold0005; HSP #1
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 47925 - 47977
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||| |||| |||||||||||||| |
|
|
| T |
47925 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
47977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005; HSP #2
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 179 - 224
Target Start/End: Complemental strand, 48225 - 48180
Alignment:
| Q |
179 |
aatatggttttagtccctgcaaatatgcctcggtttggttttagtc |
224 |
Q |
| |
|
||||||||||| ||||||||||||||||||| ||||||||||||| |
|
|
| T |
48225 |
aatatggttttggtccctgcaaatatgcctcattttggttttagtc |
48180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005; HSP #3
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 173 - 226
Target Start/End: Complemental strand, 223172 - 223119
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcct |
226 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||| ||| ||||||||||||||| |
|
|
| T |
223172 |
ggctaaaatatggttttggtccctgcaaatatgtctcactttggttttagtcct |
223119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005; HSP #4
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 282 - 324
Target Start/End: Original strand, 47972 - 48014
Alignment:
| Q |
282 |
tagtccctcaccccacttttgtgatgatttgcatacgtgacac |
324 |
Q |
| |
|
|||||||| |||||||||||||||||||||||| || |||||| |
|
|
| T |
47972 |
tagtccctgaccccacttttgtgatgatttgcacacttgacac |
48014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0001 (Bit Score: 37; Significance: 0.00000000001; HSPs: 1)
Name: scaffold0001
Description:
Target: scaffold0001; HSP #1
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 148282 - 148230
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||| |||| |||||||||||||| |
|
|
| T |
148282 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
148230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0339 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: scaffold0339
Description:
Target: scaffold0339; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 173 - 223
Target Start/End: Complemental strand, 3455 - 3405
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagt |
223 |
Q |
| |
|
||||| ||||| |||||||| |||||||||||| |||| |||||||||||| |
|
|
| T |
3455 |
ggctaaaatatagttttagttcctgcaaatatgtctcgttttggttttagt |
3405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0085 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: scaffold0085
Description:
Target: scaffold0085; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 293 - 343
Target Start/End: Complemental strand, 34967 - 34917
Alignment:
| Q |
293 |
cccacttttgtgatgatttgcatacgtgacacattataactgaaccaattt |
343 |
Q |
| |
|
||||||||| |||||||||||||| ||||||||| || |||||||| |||| |
|
|
| T |
34967 |
cccacttttatgatgatttgcatatgtgacacatgatgactgaacccattt |
34917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0119 (Bit Score: 29; Significance: 0.0000007; HSPs: 1)
Name: scaffold0119
Description:
Target: scaffold0119; HSP #1
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 16724 - 16776
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| |||||| |||| |||||||||||||| |||| |||||||||||||| |
|
|
| T |
16724 |
ggctaaaatatgattttggtccctgcaaatatatctcgttttggttttagtcc |
16776 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0078 (Bit Score: 29; Significance: 0.0000007; HSPs: 1)
Name: scaffold0078
Description:
Target: scaffold0078; HSP #1
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 173 - 221
Target Start/End: Original strand, 3752 - 3800
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggtttta |
221 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||| | | |||||||||| |
|
|
| T |
3752 |
ggctaaaatatggttttggtccctgcaaatatgctttgttttggtttta |
3800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0007 (Bit Score: 29; Significance: 0.0000007; HSPs: 2)
Name: scaffold0007
Description:
Target: scaffold0007; HSP #1
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 2501 - 2553
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||| ||| |||| ||||||||| |
|
|
| T |
2501 |
ggctaaaatatggttttgatccctgcaaatatgcttcgttttgattttagtcc |
2553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0007; HSP #2
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 173 - 225
Target Start/End: Complemental strand, 2883 - 2831
Alignment:
| Q |
173 |
ggctagaatatggttttagtccctgcaaatatgcctcggtttggttttagtcc |
225 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||| |||| |||| |||||||| |
|
|
| T |
2883 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttgagtttagtcc |
2831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University