View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18836_high_9 (Length: 389)
Name: NF18836_high_9
Description: NF18836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18836_high_9 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 179; Significance: 2e-96; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 179; E-Value: 2e-96
Query Start/End: Original strand, 84 - 368
Target Start/End: Complemental strand, 48393540 - 48393246
Alignment:
| Q |
84 |
atcgacaatgctacttttctatctgataaggaggctgcaattcctgatcatgatctcgaagctgctgcagacatggatgaagatttggattgtatttcca |
183 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48393540 |
atcgacaatgctacttttctatctgataaggaggctgcaattcctgatcatgatctcgaagctgctgcagacatggatgaagatttggattgtatttcca |
48393441 |
T |
|
| Q |
184 |
attcgctgagatacatacatgga-----tattgtacgcaaaatggaggaggaagcgagttcagatgtct----------cagaat--tttgctagttgtt |
266 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||| | || ||| |||| || ||| |
|
|
| T |
48393440 |
attcgcagagatacatacatggatattatattgtacgcaaaatggaggaggaagcgagttcagatgtttattatatatccacaatgctttgtta---gtt |
48393344 |
T |
|
| Q |
267 |
gacattgaaaatgaaattattttattattcgtgacatcacccaatcgattatgcaaacatgcctgcttgtaatgttcagcttctcggagcc-aagaaaat |
365 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
48393343 |
gacattgaaaatgaaa-----ttattattcgtgacatcacccaatcgattatgcaaacatgcctgcttgtaatgttcagcttctcggagccaaagaaaat |
48393249 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 318 - 371
Target Start/End: Complemental strand, 13857502 - 13857449
Alignment:
| Q |
318 |
tgcaaacatgcctgcttgtaatgttcagcttctcggagccaagaaaataaatct |
371 |
Q |
| |
|
|||||| |||||||| ||||||||||||||||| ||||||||||||| |||||| |
|
|
| T |
13857502 |
tgcaaagatgcctgcctgtaatgttcagcttctaggagccaagaaaaaaaatct |
13857449 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University