View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18836_low_18 (Length: 333)
Name: NF18836_low_18
Description: NF18836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18836_low_18 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 259; Significance: 1e-144; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 17 - 317
Target Start/End: Complemental strand, 44145343 - 44145039
Alignment:
| Q |
17 |
acttaactgtttgtaagcatatatttatt---tcctaatgtcatctttcttcatattatatctgtttctttttatgctgaactcaatgtcttacttatta |
113 |
Q |
| |
|
||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44145343 |
acttagctgtttgtaagcatatatttattatttcctaatgtcatctttcttcatattatatctgtttctttttatgctgaactcaatgtcttacttatta |
44145244 |
T |
|
| Q |
114 |
gacatcttttggcattacattcaagtctgggggcattttctttaagaataagatctttatatattgttataaacatgttttatgattaggaagtaacaag |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44145243 |
gacatcttttggcattacattcaagtctgggggcattttctttaagaataagatctttatagattgttataaacatgttttatgattaggaagtaacaag |
44145144 |
T |
|
| Q |
214 |
atttttaatgtaagaattataatctttgttg-ttggtacctaatgaggataagaaaagttaaaaatccctttcagggtatggtgcaaagttctgcagaga |
312 |
Q |
| |
|
|||||||||||| ||||||||||||||| || ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
44145143 |
atttttaatgtatgaattataatctttgctgtttgttacctaatgaggataagaaaagttaaaaatccctttcagggtatggtgcaaagttctacagaga |
44145044 |
T |
|
| Q |
313 |
tcttg |
317 |
Q |
| |
|
||||| |
|
|
| T |
44145043 |
tcttg |
44145039 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University