View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18836_low_25 (Length: 261)
Name: NF18836_low_25
Description: NF18836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18836_low_25 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 1 - 247
Target Start/End: Original strand, 40983359 - 40983594
Alignment:
| Q |
1 |
tagagtggtagcaaaaagagagttattagatctcctcaatttaaaaacccaataatacatctcattctagatgctcttcctcatcttaggtgaaaaagat |
100 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40983359 |
tagagtggtagtaaaaagagagttattagatctcctcaatttaaaaacccaataatacatctcattctagatgctcttcctcatcttaggtgaaaaagat |
40983458 |
T |
|
| Q |
101 |
gctcttcttcatcctaggagaaaaatactgaccgattgatagagcatttcgaatatagtaagcagggatttgagacaattccaaaataattgcattgctt |
200 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||| |
|
|
| T |
40983459 |
gctcttcttcatcc-----------tactgaccgattgatagagcatttcgaatatagtaagcagagatttgagacaattacaaaataattgcattgctt |
40983547 |
T |
|
| Q |
201 |
ttaattactaagaatcattttccttaaataacccatctacttcttac |
247 |
Q |
| |
|
||||||| ||||||||||||||||||||||| |||||| |||||||| |
|
|
| T |
40983548 |
ttaattattaagaatcattttccttaaataatccatctgcttcttac |
40983594 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University