View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18837_high_16 (Length: 303)
Name: NF18837_high_16
Description: NF18837
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18837_high_16 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 263; Significance: 1e-147; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 263; E-Value: 1e-147
Query Start/End: Original strand, 8 - 286
Target Start/End: Original strand, 3171810 - 3172088
Alignment:
| Q |
8 |
tgaaatgaaatttggatttcctgaaatgtttgacttggaagccgaccaaaaactagatgcttcagagaagtcagattttgcatccaattctttgggaatt |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3171810 |
tgaaatgaaatttggatttcctgaaatgtttgacttggaagatgaccaaaaactagatgcttcagagaagtcagattttgcatccaattctttgggaatt |
3171909 |
T |
 |
| Q |
108 |
ttttcacatcgagatcaacatccacaagtttcaactcttttatcaacgaaagaggaaggacttcaatcgaagaatttgaatctaccatgtttaaagttgc |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3171910 |
ttttcacatcgagatcaacatccacaagtttcaactcttttatcaatgaaagaggaaggacttcaatcgaagaatttgaatctaccatgtttaaagttgc |
3172009 |
T |
 |
| Q |
208 |
ttccagtgccttcacactactagaatgagttaaactcaatgttttgtcaagttttggaaatgtaggtatgtgaatcaac |
286 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
3172010 |
ttccagtgccttcacactactagaatgagttaaactcaatgttttgtcaagttttggaaatgtaggtatgtgactcaac |
3172088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 71 - 114
Target Start/End: Complemental strand, 3004383 - 3004340
Alignment:
| Q |
71 |
agagaagtcagattttgcatccaattctttgggaattttttcac |
114 |
Q |
| |
|
|||||||| |||||||||| |||||||||||||| ||||||||| |
|
|
| T |
3004383 |
agagaagtgagattttgcaaccaattctttgggagttttttcac |
3004340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 62 - 116
Target Start/End: Original strand, 3140231 - 3140285
Alignment:
| Q |
62 |
agatgcttcagagaagtcagattttgcatccaattctttgggaattttttcacat |
116 |
Q |
| |
|
|||||||| |||||||||||| |||||| ||||| || ||||| ||||||||||| |
|
|
| T |
3140231 |
agatgcttgagagaagtcagaatttgcaaccaatcctctgggagttttttcacat |
3140285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 23 - 117
Target Start/End: Complemental strand, 7161570 - 7161476
Alignment:
| Q |
23 |
atttcctgaaatgtttgacttggaagccgaccaaaaactagatgcttcagagaagtcagattttgcatccaattctttgggaattttttcacatc |
117 |
Q |
| |
|
||||||||||||||| ||||||||||| |||||| ||||||| || |||||||||||||||| ||||| ||| || ||||||| ||||| |
|
|
| T |
7161570 |
atttcctgaaatgttcgacttggaagcttcataaaaacaagatgctcgagggaagtcagattttgcacccaatccttcaggtatttttttacatc |
7161476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University