View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18837_high_27 (Length: 259)
Name: NF18837_high_27
Description: NF18837
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18837_high_27 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 93; Significance: 2e-45; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 130 - 222
Target Start/End: Complemental strand, 779610 - 779518
Alignment:
| Q |
130 |
gctagggcaaagaatgaaattcgttattttcttacctgctaagccactttccccatccttcttctccgtcccaaccccggacttctcatcgtt |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
779610 |
gctagggcaaagaatgaaattcgttattttcttacctgctaagccactttccccatccttcttctccgtcccaaccccggacttctcatcgtt |
779518 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 21 - 68
Target Start/End: Complemental strand, 779719 - 779672
Alignment:
| Q |
21 |
aaaatactcaacaagacatcaataacacaaggatcatgactaatagtt |
68 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
779719 |
aaaatactcaacaagacatcaataacacaaggatcatgactaatagtt |
779672 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University