View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18837_high_29 (Length: 249)
Name: NF18837_high_29
Description: NF18837
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18837_high_29 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 1 - 233
Target Start/End: Complemental strand, 7545044 - 7544809
Alignment:
| Q |
1 |
cgtcgaaagaatgaatgacaatatccgccctaacggggaggtgaaggtgcagttgagtgggccagaaagccacccttcaaccttttctt---gtattttg |
97 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
7545044 |
cgtcgaaagaatgaatgacaatatccgccctaacggggaggtgaaggtgcagttgagtgggccagaaagccacccttcaaccttttcttcttgtattttg |
7544945 |
T |
 |
| Q |
98 |
gatgggttccaacatccttttaaagttgtcaaaactttttagtgtcttgtcagaggcctttgcattgatgttgggaggaatcaggagtggctggggcaat |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7544944 |
gatgggttccaacatccttttaaagttgtcaaaactttttagtgtcttgtcagaggcctttgcattgatgttgggaggaatcaggagtggctggggcaat |
7544845 |
T |
 |
| Q |
198 |
gaaattgttttcaaaagaaaaacaaagccaataatt |
233 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
7544844 |
gaaattgttttcaaaagaaaaacaaagccaataatt |
7544809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University