View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18837_high_32 (Length: 223)
Name: NF18837_high_32
Description: NF18837
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18837_high_32 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 151; Significance: 5e-80; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 14 - 175
Target Start/End: Complemental strand, 3881945 - 3881783
Alignment:
| Q |
14 |
aacctgtggaccaaggaatgagtaactcattaaacaaaataatgttaggagttttgcccactttttcctctctcttttcagtccccttctatctccattt |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3881945 |
aacctgtggaccaaggaatgagtaactcattaaacaaaataatgttaggagttttgcccactttttcctctctcttttcagtccccttctatctccattt |
3881846 |
T |
 |
| Q |
114 |
tccagccaatttctgtgtcttcattgttgcagaa-caggaaacgatgaaaaatgaaataaatg |
175 |
Q |
| |
|
||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
3881845 |
tccagccaatttctgcgtcttcattgttgcagaagcaggaaacgatgaaaaatgaaataaatg |
3881783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University