View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18837_low_19 (Length: 294)
Name: NF18837_low_19
Description: NF18837
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18837_low_19 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 1 - 272
Target Start/End: Original strand, 6285646 - 6285917
Alignment:
| Q |
1 |
acatttgtcaacggtattttagttttgggcatttctaacccttaaaagacatcacgatgcaacttatctnnnnnnntatatcaaataattttataaaaag |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
6285646 |
acatttgtcaacggtattttagttttgggcatttctaacccttaaaagacatcacgatgcaacttatctaaaaaaatatatcaaataattttataaaaag |
6285745 |
T |
 |
| Q |
101 |
agttgctacnnnnnnntaattcctactttaaagaaacaatgatgtgaaagttttactaataaaatgaaaagaatg-nnnnnnnngttgctaaattacaat |
199 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
6285746 |
agttgctac-aaaaaataattcctactttaaagaaacaatgatgtgaaagttttactaatagaatgaaaagaatgtttgtttttgttgctaaattacaat |
6285844 |
T |
 |
| Q |
200 |
ttaggtcccttaagttattcttaagtttcactttgtcctttgagctatttttgttatgttttgaccaaataag |
272 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6285845 |
ttagttcccttaagttattcttaagtttcactttgtcctttgagctatttttgttatgttttgaccaaataag |
6285917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University