View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18837_low_25 (Length: 272)
Name: NF18837_low_25
Description: NF18837
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18837_low_25 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 47; Significance: 7e-18; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 210 - 256
Target Start/End: Original strand, 51388904 - 51388950
Alignment:
| Q |
210 |
tgctacattcttctttcatcccacaacattggcattcagcttcttct |
256 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51388904 |
tgctacattcttctttcatcccacaacattggcattcagcttcttct |
51388950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 45; Significance: 1e-16; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 81 - 204
Target Start/End: Complemental strand, 22763098 - 22762976
Alignment:
| Q |
81 |
aaaacaagaacatgatatagtgttgtataaacgctaagaataaaatcatgaaggnnnnnnnnnnggaatatagaaagtagtaaaagtgagattagtgata |
180 |
Q |
| |
|
|||||||||||||||||| |||||||||||| | ||||||||||| || ||||| |||||||||||||| |||||| ||||||||||| || |
|
|
| T |
22763098 |
aaaacaagaacatgatatcgtgttgtataaatgttaagaataaaaacaggaaggaaaaaaaat-ggaatatagaaagtggtaaaaatgagattagtggta |
22763000 |
T |
 |
| Q |
181 |
ctacttacatgtctttatgatttt |
204 |
Q |
| |
|
|||||||||| |||| || ||||| |
|
|
| T |
22762999 |
ctacttacatttcttcatcatttt |
22762976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 1 - 93
Target Start/End: Complemental strand, 22763212 - 22763118
Alignment:
| Q |
1 |
tttgggctgcccaatcgagatcga-caaacaacaatatcatgatcatgcaattgcaagtaa-gattactgacgtagtaacagaaaacaagaacat |
93 |
Q |
| |
|
||||||||||| ||||||||||| |||||| ||| ||||||||| |||||||||| | || ||||| ||| ||||| ||| ||||||||||||| |
|
|
| T |
22763212 |
tttgggctgcctaatcgagatcgggcaaacaccaacatcatgatcgtgcaattgcaggaaaagattattgaggtagtgacataaaacaagaacat |
22763118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University