View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18837_low_25 (Length: 272)

Name: NF18837_low_25
Description: NF18837
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18837_low_25
NF18837_low_25
[»] chr3 (1 HSPs)
chr3 (210-256)||(51388904-51388950)
[»] chr5 (2 HSPs)
chr5 (81-204)||(22762976-22763098)
chr5 (1-93)||(22763118-22763212)


Alignment Details
Target: chr3 (Bit Score: 47; Significance: 7e-18; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 210 - 256
Target Start/End: Original strand, 51388904 - 51388950
Alignment:
210 tgctacattcttctttcatcccacaacattggcattcagcttcttct 256  Q
    |||||||||||||||||||||||||||||||||||||||||||||||    
51388904 tgctacattcttctttcatcccacaacattggcattcagcttcttct 51388950  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 45; Significance: 1e-16; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 81 - 204
Target Start/End: Complemental strand, 22763098 - 22762976
Alignment:
81 aaaacaagaacatgatatagtgttgtataaacgctaagaataaaatcatgaaggnnnnnnnnnnggaatatagaaagtagtaaaagtgagattagtgata 180  Q
    |||||||||||||||||| |||||||||||| | ||||||||||| || |||||          |||||||||||||| |||||| ||||||||||| ||    
22763098 aaaacaagaacatgatatcgtgttgtataaatgttaagaataaaaacaggaaggaaaaaaaat-ggaatatagaaagtggtaaaaatgagattagtggta 22763000  T
181 ctacttacatgtctttatgatttt 204  Q
    |||||||||| |||| || |||||    
22762999 ctacttacatttcttcatcatttt 22762976  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 1 - 93
Target Start/End: Complemental strand, 22763212 - 22763118
Alignment:
1 tttgggctgcccaatcgagatcga-caaacaacaatatcatgatcatgcaattgcaagtaa-gattactgacgtagtaacagaaaacaagaacat 93  Q
    ||||||||||| |||||||||||  |||||| ||| ||||||||| |||||||||| | || ||||| ||| ||||| ||| |||||||||||||    
22763212 tttgggctgcctaatcgagatcgggcaaacaccaacatcatgatcgtgcaattgcaggaaaagattattgaggtagtgacataaaacaagaacat 22763118  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University