View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18837_low_28 (Length: 259)

Name: NF18837_low_28
Description: NF18837
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18837_low_28
NF18837_low_28
[»] chr1 (2 HSPs)
chr1 (130-222)||(779518-779610)
chr1 (21-68)||(779672-779719)


Alignment Details
Target: chr1 (Bit Score: 93; Significance: 2e-45; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 130 - 222
Target Start/End: Complemental strand, 779610 - 779518
Alignment:
130 gctagggcaaagaatgaaattcgttattttcttacctgctaagccactttccccatccttcttctccgtcccaaccccggacttctcatcgtt 222  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
779610 gctagggcaaagaatgaaattcgttattttcttacctgctaagccactttccccatccttcttctccgtcccaaccccggacttctcatcgtt 779518  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 21 - 68
Target Start/End: Complemental strand, 779719 - 779672
Alignment:
21 aaaatactcaacaagacatcaataacacaaggatcatgactaatagtt 68  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||    
779719 aaaatactcaacaagacatcaataacacaaggatcatgactaatagtt 779672  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University