View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18837_low_30 (Length: 249)

Name: NF18837_low_30
Description: NF18837
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18837_low_30
NF18837_low_30
[»] chr2 (1 HSPs)
chr2 (1-233)||(7544809-7545044)


Alignment Details
Target: chr2 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 1 - 233
Target Start/End: Complemental strand, 7545044 - 7544809
Alignment:
1 cgtcgaaagaatgaatgacaatatccgccctaacggggaggtgaaggtgcagttgagtgggccagaaagccacccttcaaccttttctt---gtattttg 97  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||   ||||||||    
7545044 cgtcgaaagaatgaatgacaatatccgccctaacggggaggtgaaggtgcagttgagtgggccagaaagccacccttcaaccttttcttcttgtattttg 7544945  T
98 gatgggttccaacatccttttaaagttgtcaaaactttttagtgtcttgtcagaggcctttgcattgatgttgggaggaatcaggagtggctggggcaat 197  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
7544944 gatgggttccaacatccttttaaagttgtcaaaactttttagtgtcttgtcagaggcctttgcattgatgttgggaggaatcaggagtggctggggcaat 7544845  T
198 gaaattgttttcaaaagaaaaacaaagccaataatt 233  Q
    ||||||||||||||||||||||||||||||||||||    
7544844 gaaattgttttcaaaagaaaaacaaagccaataatt 7544809  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University